Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 12, Number 11—November 2006
Dispatch

Human Parainfluenza Type 4 Infections, Canada

Marie-Louise Vachon*†, Natasha Dionne*†, Éric Leblanc*†, Danielle Moisan‡, Michel G. Bergeron*†, and Guy Boivin*†Comments to Author 
Author affiliations: *Research Center in Infectious Diseases of the Centre Hospitalier Universitaire de Québec, Quebec City, Quebec, Canada; †Laval University, Quebec City, Quebec, Canada; ‡Centre Hospitalier Régional du Grand-Portage, Rivière-du-Loup, Quebec, Canada

Main Article

Table 1

Cell lines used for viral culture and primers used for HPIV-4 PCR testing

Cell lines Oligonucleotide sequences (5´–3´) Target genes
Mink lung ATGGGTGTCAAAGGTTTATC Fusion
Human foreskin fibroblast (forward)
Human lung carcinoma (A-549)
Vero AATTATGCAGATTGTAACTGTC
Hep-2 (reverse)
Human rhabdomyosarcoma (RD) ATGGTGAAAAGAACATGGAG Hemagglutinin-neuraminidase
Transformed human kidney 293 (forward)
Human colon adenocarcinoma (HT-29) TGGAGTATCCAGCAGTAAGA
Madin-Darby canine kidney (MDCK) (reverse)
Tertiary monkey kidney (LLC-MK2)

Main Article

Page created: October 14, 2011
Page updated: October 14, 2011
Page reviewed: October 14, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external