Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 12, Number 2—February 2006
Dispatch

Arcobacter butzleri: Underestimated Enteropathogen

Tables
Article Metrics
139
citations of this article
EID Journal Metrics on Scopus
Author affiliations: *Hôpital Pellegrin, Bordeaux, France; †Université Victor Segalen Bordeaux 2, Bordeaux, France

Cite This Article

Abstract

Molecular methods applied to 2,855 strains of Campylobacter-like organisms received from a surveillance network of Campylobacter infections in France identified 29 Arcobacter butzleri infections. This species ranks fourth for Campylobacteraceae isolation and appears to have the same pathogenic potential as the other species in the genus.

Kiehlbauch et al. (1) originally described the species Arcobacter butzleri, previously named Campylobacter butzleri (1), after studying aerotolerant Campylobacter strains from human and veterinary sources. The genus Arcobacter was created in 1992 (2).

A. butzleri is found in environmental samples, and untreated water appears to be a potential source of infection. In industrialized countries, the most important source of human contamination may be food. Indeed, A. butzleri has been isolated in different breeding animals and is present in a great variety of retail meats, including chicken, beef, pork, and lamb, with a high prevalence in poultry (3).

Although the prevalence of this bacterium in animals and food specimens is well documented, including the first publication by Kiehlbauch et al. that implied this newly described species could be an important human pathogen, only a few reports of human infections are found, and most of them were published before 1995. In the Far East, Taylor et al. formally identified A. butzleri in 2.4% of diarrheal stool samples collected from Thai children (4), and more recently, 2 bacteremia cases were reported in Taiwan and Hong Kong in patients with an underlying disease (liver cirrhosis and gangrenous appendicitis, respectively) (5,6). In a South African study, 15 A. butzleri were identified among 3,877 Campylobacteraceae strains isolated from children's diarrheic stools (7). Reports from Europe are scarce: an outbreak of recurrent abdominal cramps in 10 patients in Italy (8), bacteremia in a newborn in the United Kingdom (9), and 2 cases of severe diarrhea in Germany (10). The recent publication of Vandenberg et al. from Belgium used an Arcobacter-selective medium for stool specimens and found that A. butzleri ranked fourth among Campylobacter spp. and Campylobacter-like organisms (11), which stimulated interest to revisit the role of Arcobacter spp. as an agent of enteric infection.

In this study, our goal was to investigate the prevalence of A. butzleri with a different approach and to describe the clinical features of A. butzleri infection. We used molecular methods to identify Campylobacter-related organisms collected from a network of clinical laboratories that do not use specific Arcobacter-selective medium. The results nevertheless showed that this bacterium ranks fourth among these organisms.

The Study

The French surveillance network of human Campylobacter infections is composed of laboratories selected on a voluntary basis (12). The laboratories are randomly located throughout France; 93 are hospital laboratories, and 338 are private laboratories. They send their clinical Campylobacter isolates to the National Reference Center with a completed information sheet concerning the patient and epidemiologic data. The study period was from July 2002 to December 2003, and 2,855 Campylobacter-like strains were studied. In addition to standard phenotypic identification, specific polymerase chain reaction (PCR) assays were carried out to identify C. jejuni, C. coli, or C. fetus (13); other isolates were identified by comparing 2 sequences of 400 bp located at both extremities of a 1,100-bp fragment of the beginning of the 16S rRNA gene amplified with primers F2-16S-CHPEC (ATCCTGGCTCAGAGTGAACG) and R2-16S-CHPEC (AAGGGCCATGATGACTTGAC) with those of DNA databases by using the BLAST program (http://www.ncbi.nlm.nih.gov/blast/). An identification at the species level was regarded as correct when >99% identity was seen with only 1 species. The species distribution from stool samples was as follows: 2,114 C. jejuni (78.9%), 486 C. coli (18.1%), 36 C. fetus (1.3%), 27 A. butzleri (1.0%), 8 C. lari (0.3%), 4 C. upsaliensis (0.1%), 2 C. hyointestinalis, and 1 Helicobacter canadensis. From 177 nonstool samples, we detected 2 A. butzleri.

Almost the entire 16S rRNA gene, 1,450 bp, was sequenced for 9 A. butzleri to study its homogeneity because only 5 sequences are in the databank (accession nos. AF314538, AY621116, L14626, U34386, U34388). The intraspecies variability was only 0.4% (6/1,430 bp) among the 14 A. butzleri sequences. Comparison of these sequences with those of 4 A. cryaerophilus (AY314755, L14624, U34387, U25805), 1 A. skirrowii (L14625), and 1 A. nitrofigilis (L14627) showed that interspecies variability concerned 14 bp out of 1,430. The Arcobacter sequences differed considerably from those of Campylobacter spp., with only 86.2% identity with C. coli (AY621115) and 85.6% identity with C. fetus (AY621110), 2 species that can be phenotypically confounded with A. butzleri.

Twenty-seven of the 29 A. butzleri strains were isolated from feces of patients with gastroenteritis, whereas 1 strain was isolated from peritonitis pus and another from a blood culture specimen. The 27 Arcobacter strains from stools were isolated in 23 different laboratories. Most of them (n = 15) used Campylosel (bioMérieux, Marcy l'Etoile, France) incubated at 37°C for 2 to 3 days. Six used Karmali agar incubated at 37°C for 3 to 4 days. The last 2 used Butzler medium and the filtration method, respectively. None of these infections was part of an outbreak. Of the 16 patients with travel information available, only 1 indicated a recent trip, to Turkey. An associated pathogenic organism was described in 1 of 15 cases, but the nature of the associated organism is unknown. Seventeen of the 29 patients were hospitalized. Their age range was 1–89 years, with an average of 54 years. Seventeen patients (59%) were male. Detailed clinical information was obtained for 19 patients and is shown in the Table. Eighteen of 19 patients had diarrhea, including the patient with bacteremia; 11 of 15 had abdominal pain; 4 of 15 had bloody stools, including the patient with A. butzleri bacteremia; 2 of 14 patients vomited; and 5 of 17 patients had fever. Acute renal failure developed in 2 patients, 1 associated with pyelonephritis. Concerning the 17 other cases for which information was available, severe clinical symptoms (anorexia, weight loss, asthenia) were described for 10 patients.

The duration of symptoms without treatment was variable, from 2 days to several weeks. Antimicrobial drug therapy was administered in 5 cases, and infection was eradicated a few days later (Table). In all cases, the strains were susceptible to the antimicrobial agent used (amoxicillin, ofloxacin, ciprofloxacin [twice], amoxicillin-clavulanate).

Conclusions

During an 18-month period, 2,855 strains of Campylobacter-like organisms were identified at the species level by using phenotypic and molecular tools. Molecular methods permitted the identification of 29 A. butzleri, i.e., 1% of the strains studied and also 1% of the 2,678 isolates from stools, which makes this species the fourth most frequently isolated Campylobacteraceae in human clinical samples in France, before C. lari and C. upsaliensis but after C. jejuni, C. coli, and C. fetus. Our results agree with those of Vandenberg et al. (11) who also found A. butzleri in fourth position for Campylobacter-like isolates from stool specimens. However, their results were obtained in a different context: only 1 laboratory was involved for 8 years, and a specific Arcobacter-selective medium was used. A study conducted in Denmark by Engberg et al. (14), also to estimate the prevalence of Campylobacter spp. and related bacteria in human fecal samples, did not produce the same results; only 1 A. butzleri was isolated out of 1,376 samples, and no C. lari or C. upsaliensis was recovered. The differences between these 3 studies could be explained by differences in geographic distribution of the species, but the difference in isolation methods (selective agar in the Belgian study) or in identification methods (molecular methods in our study) is likely the critical point. While not optimal, Campylobacter-selective agars, especially Campylosel, appear to allow the growth of A. butzleri. For the other media, a longer incubation period seems necessary. The role of A. butzleri in enteric infections is not definitively proven, but its involvement is likely. In at least 14 of 15 cases, no other enteropathogen was detected. In 1 case, a bacteremia with an enteric infection was found. These data are similar to those observed with C. jejuni infection. Isolation of A. butzleri is more frequent than well-known enteropathogenic Campylobacter spp., e.g., C. upsaliensis and C. lari, when adequate identification is carried out. The prevalence of A. butzleri may be underestimated because of false identification as C. coli or C. fetus. Indeed nearly all of the strains are able to grow at 25°C, like C. fetus, but are resistant to cephalothin like C. coli. We found that nearly all of the strains were resistant to nalidixic acid (4 had an intermediary resistance) and susceptible to ciprofloxacin with the disk diffusion method. The choice of a simple method for testing these drugs allows it to be used routinely in clinical laboratories to differentiate such strains phenotypically.

Nevertheless, molecular biology is a powerful tool for diagnosis. We used a 16S rRNA gene sequencing as a global approach for strains that were not C. jejuni, C. coli, or C. fetus. We confirmed that the intraspecies variability of A. butzleri 16S rRNA gene sequences is low (0.4%), lower than that found for C. coli (1.5%) or C. lari (2.5%) (15), and that interspecies variability is high. This approach, which is expensive and difficult to implement, is not accessible to a routine laboratory, but simple phenotypic tests can be applied to detect these microorganisms. The combination of phenotypic tests and selective agar medium will determine the real incidence of A. butzleri infection, which will add evidence that A. butzleri is an etiologic agent of diarrhea. A determination of the prevalence of A. butzleri in normal stool will also help establish the prevalence of this organism in diarrheal stool.

Dr Prouzet-Mauléon is an engineer at the National Reference Center for Campylobacters and Helicobacters. She is responsible for the analyses and development of molecular methods applied to the diagnosis and characterization of Campylobacteraceae.

Top

Acknowledgment

We thank the laboratories participating in our network in France for sending their Campylobacter strains to the National Reference Center for Campylobacters and Helicobacters.

Top

References

  1. Kiehlbauch  JA, Brenner  DJ, Nicholson  MA, Baker  CN, Patton  CM, Steigerwalt  AG, Campylobacter butzleri sp. nov. isolated from humans and animals with diarrheal illness. J Clin Microbiol. 1991;29:37685.PubMedGoogle Scholar
  2. Vandamme  P, Vancanneyt  M, Pot  B, Mels  L, Hoste  B, Dewettinck  D, Polyphasic taxonomic study of the emended genus Arcobacter with Arcobacter butzleri comb. nov. and Arcobacter skirrowii sp. nov., an aerotolerant bacterium isolated from veterinary specimens. Int J Syst Bacteriol. 1992;42:34456. DOIPubMedGoogle Scholar
  3. Houf  K, De Zutter  L, Verbeke  B, Van Hoof  J, Vandamme  P. Molecular characterization of Arcobacter isolates collected in a poultry slaughterhouse. J Food Prot. 2003;66:3649.PubMedGoogle Scholar
  4. Taylor  DN, Kiehlbauch  JA, Tee  W, Pitarangsi  C, Echeverria  P. Isolation of group 2 aerotolerant Campylobacter species from Thai children with diarrhea. J Infect Dis. 1991;163:10627. DOIPubMedGoogle Scholar
  5. Yan  JJ, Ko  WC, Huang  AH, Chen  HM, Jin  YT, Wu  JJ. Arcobacter butzleri bacteremia in a patient with liver cirrhosis. J Formos Med Assoc. 2000;99:1669.PubMedGoogle Scholar
  6. Lau  SKP, Woo  PCY, Teng  JLL, Leung  KW, Yuen  KY. Identification by 16S ribosomal RNA gene sequencing of Arcobacter butzleri bacteraemia in a patient with acute gangrenous appendicitis. Mol Pathol. 2002;55:1825. DOIPubMedGoogle Scholar
  7. Lastovica  AJ, Skirrow  MB. Clinical significance of Campylobacter and related species other than Campylobacter jejuni and C. coli. In: Nachamkin I, Blaser MJ, editors. Campylobacter. 2nd ed. Washington: American Society for Microbiology; 2000. p. 89–120.
  8. Vandamme  P, Pugina  P, Benzi  G, van Etterijck  R, Vlaes  L, Kersters  K, Outbreak of recurrent abdominal cramps associated with Arcobacter butzleri in an Italian school. J Clin Microbiol. 1992;30:23357.PubMedGoogle Scholar
  9. On  SL, Stacey  A, Smyth  J. Isolation of Arcobacter butzleri from a neonate with bacteraemia. J Infect. 1995;31:2257. DOIPubMedGoogle Scholar
  10. Lerner  J, Brumberger  V, Preac-Mursic  V. Severe diarrhea associated with Arcobacter butzleri. Eur J Clin Microbiol Infect Dis. 1994;13:6602. DOIPubMedGoogle Scholar
  11. Vandenberg  O, Dediste  A, Houf  K, Ibekwem  S, Souayah  H, Cadranel  S, Arcobacter species in humans. Emerg Infect Dis. 2004;10:18637.PubMedGoogle Scholar
  12. Gallay  A, Simon  F, Megraud  F. Surveillance of human Campylobacter infections in France—part 2—implementation of national surveillance. Euro Surveill. 2003;8:218.PubMedGoogle Scholar
  13. Menard  A, Dachet  F, Prouzet-Mauleon  V, Oleastro  M, Megraud  F. Development of a real-time fluorescence resonance energy transfer PCR to identify the main pathogenic Campylobacter spp. Clin Microbiol Infect. 2005;11:2817. DOIPubMedGoogle Scholar
  14. Engberg  J, On  SLW, Harrington  CS, Gerner Smidt  P. Prevalence of Campylobacter, Arcobacter, Helicobacter, and Sutterella spp. in human fecal samples as estimated by a reevaluation of isolation methods for campylobacters. J Clin Microbiol. 2000;38:28691.PubMedGoogle Scholar
  15. Gorkiewicz  G, Feierl  G, Schober  C, Dieber  F, Kofer  J, Zechner  R, Species-specific identification of campylobacters by partial 16S rRNA gene sequencing. J Clin Microbiol. 2003;41:253746. DOIPubMedGoogle Scholar

Top

Table

Top

Cite This Article

DOI: 10.3201/eid1202.050570

Table of Contents – Volume 12, Number 2—February 2006

EID Search Options
presentation_01 Advanced Article Search – Search articles by author and/or keyword.
presentation_01 Articles by Country Search – Search articles by the topic country.
presentation_01 Article Type Search – Search articles by article type and issue.

Top

Comments

Please use the form below to submit correspondence to the authors or contact them at the following address:

Francis Mégraud, Laboratoire de Bactériologie, Hôpital Pellegrin, Place Amélie Raba Léon, 33076 Bordeaux, France; fax: 33-5-56-79-60-18

Send To

10000 character(s) remaining.

Top

Page created: February 02, 2012
Page updated: February 02, 2012
Page reviewed: February 02, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external