Volume 13, Number 8—August 2007
Dispatch
PCR versus Hybridization for Detecting Virulence Genes of Enterohemorrhagic Escherichia coli
Table
Virulence factor targets and primers, including nucleotide sequences, reference, and PCR conditions*
Primer name | Nucleotide sequence (5′→3′) | Target (bp) | Ref. | PCR conditions |
||
---|---|---|---|---|---|---|
Denature | Anneal | Extension | ||||
STX1U | GTAACATCGCTCTTGCCACA | Stx1 gene (204) | This study | 95°C, 60 s | 53.7°C, 60 s | 72°C, 240 s |
STX1D | CGCTTTGCTGATTTTTCACA | |||||
STX2U | GTTCCGGAATGCAAATCAGT | Stx2 gene (206) | This study | 95°C, 60 s | 53.7°C, 60 s | 72°C, 240 s |
STX2D | CGGCGTCATCGTATACACAG | |||||
eae-1 | ACGTTGCAGCATGGGTAACTC | Intimin (818) | (8) | 95°C, 60 s | 57.1°C, 60 s | 72°C, 240 s |
eae-2 | GATCGGCAACAGTTTCACCTG | |||||
ToxBF | TGGCCTTGCGCTCTATAAGAACCT | ToxB (823) | This study | 95°C, 60 s | 60°C, 60 s | 72°C, 240 s |
ToxBR | ACCACGCCGTGAGAATAATGTCCA | |||||
HlyA1F | GGTGCAGCAGAAAAAGTTGTAG | HlyA (1551) | (13) | 95°C, 60 s | 55.5°C,60 s | 72°C, 240 s |
HlyA1R | TCTCGCCTGATAGTGTTTGGTA | |||||
EspPF | CGGCAGAGTATCATCAAGAGC | EspP (397) | This study | 95°C, 60 s | 55.5°C, 60 s | 72°C, 240 s |
EspPR | CATTAAATGGAGTTATGCGTC | |||||
KatPF | TTTAAAACGCTGGGATTTGC | KatP (1174) | This study | 95°C,60 s | 52.0°C, 60 s | 72°C, 240 s |
KatPR | CTCCTGAGAGGCGTCAGTTC | |||||
MalBU | GACCTCGGTTTAGTTCACAGA | MalB promoter (414) | This study | 95°C, 60 s | 55.8°C, 60 s | 72°C, 240 s |
MalBDn | AGCGCGTAGGACTGAAACACCATA | |||||
ORF1F | TTTTTCAAAGCAAATGATGTGG | ORF 1 pOSAK1 (385) | This study | 95°C, 60 s | 49.8°C, 60 s | 72°C, 240 s |
ORF1R | GGCGTAGCTAGGTTGAAATTATG | |||||
ORF2F | CAA CCTAGCTACGCCACCAT | ORF 2 pOSAK1 (869) | This study | 95°C, 60 s | 54.3°C, 60 s | 72°C, 240 s |
ORF2R | CATCAGGCGGAAATACCACT | |||||
EAF1 | CAGGGTAAAAGAAAGATGATAA | Eaf (397) | (14) | 95°C, 60 s | 49.8°C, 60 s | 72°C, 240 s |
EAF2 | TATGGGGACCATGTATTATCA | |||||
BFP1 | GATTGAATCTGCAATGGC | Bfp (597) | (15) | 95°C, 60 s | 51.6°C, 60 s | 72°C, 240 s |
BFP2 | GGATTACTGTCCTCACATAT |
*Ref., reference; ORF, open reading frame.
References
- Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142–201.PubMedGoogle Scholar
- Makino S, Tobe T, Asakura H, Watarai M, Ikeda T, Takeshi K, Distribution of the secondary type III secretion system locus found in enterohemorrhagic Escherichia coli O157:H7 isolates among Shiga toxin–producing E. coli strains. J Clin Microbiol. 2003;41:2341–7. DOIPubMedGoogle Scholar
- Hacker J, Kaper JB. Pathogenicity islands and the evolution of microbes. Annu Rev Microbiol. 2000;54:641–79. DOIPubMedGoogle Scholar
- Burland V, Shao Y, Perna NT, Plunkett G. Sofia HJBlattner FR. The complete DNA sequence and analysis of the large virulence plasmid of Escherichia coli O157:H7. Nucleic Acids Res. 1998;26:4196–204. DOIPubMedGoogle Scholar
- Farmer JJ III, Davis BR. H7 antiserum-sorbitol fermentation medium: a single tube screening medium for detecting Escherichia coli O157:H7 associated with hemorrhagic colitis. J Clin Microbiol. 1985;22:620–5.PubMedGoogle Scholar
- Osek J. Development of a multiplex PCR approach for the identification of Shiga toxin–producing Escherichia coli strains and their major virulence factor genes. J Appl Microbiol. 2003;95:1217–25. DOIPubMedGoogle Scholar
- Prager R, Annemuller S, Tschape H. Diversity of virulence patterns among Shiga toxin–producing Escherichia coli from human clinical cases-need for more detailed diagnostics. Int J Med Microbiol. 2005;295:29–38. DOIPubMedGoogle Scholar
- Blanco JE, Blanco M, Blanco J, Mora A, Balaguer L, Mourino M, O serogroups, biotypes, and eae genes in Escherichia coli strains isolated from diarrheic and healthy rabbits. J Clin Microbiol. 1996;34:3101–7.PubMedGoogle Scholar
- Brunder W, Schmidt H, Frosch M, Karch H. The large plasmids of Shiga-toxin–producing Escherichia coli (STEC) are highly variable genetic elements. Microbiology. 1999;145:1005–14. DOIPubMedGoogle Scholar
- Makino K, Ishii K, Yasunaga T, Hattori M, Yokoyama K, Yutsudo CH, Complete nucleotide sequences of 93-kb and 3.3-kb plasmids of an enterohemorrhagic Escherichia coli O157:H7 derived from Sakai outbreak. DNA Res. 1998;5:1–9. DOIPubMedGoogle Scholar
- Brunder W. Schmidt H, Karch H. KatP, a novel catalase-peroxidase encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7. Microbiology. 1996;142:3305–15. DOIPubMedGoogle Scholar
- Tatsuno I, Horie M, Abe H, Miki T, Makino K, Shinagawa H, toxB gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect Immun. 2001;69:6660–9. DOIPubMedGoogle Scholar
- Schmidt H, Beutin L, Karch H. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect Immun. 1995;63:1055–61.PubMedGoogle Scholar
- Franke J, Franke S, Schmidt H, Schwarzkopf A, Wieler LH, Baljer G, Nucleotide sequence analysis of enteropathogenic Escherichia coli (EPEC) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J Clin Microbiol. 1994;32:2460–3.PubMedGoogle Scholar
- Wieler LH, Vieler E, Erpenstein C, Schlapp T, Steinruck H, Bauerfeind R, Shiga toxin-producing Escherichia coli strains from bovines: association of adhesion with carriage of eae and other genes. J Clin Microbiol. 1996;34:2980–4.PubMedGoogle Scholar