Isolation of Kyasanur Forest Disease Virus from Febrile Patient, Yunnan, China
Jinglin Wang, Hailin Zhang, Shihong Fu, Huanyu Wang, Daxin Ni, Roger S. Nasci, Qing Tang, and Guo-Dong Liang
Author affiliations: State Key Laboratory for Infectious Disease Prevention and Control, Beijing, China (J. Wang, S. Fu, H. Wang, D. Ni, Q. Tang, G. Liang); Yunnan Institute of Endemic Disease Control and Prevention, Dali, China (J. Wang, H. Zhang); Centers for Disease Control and Prevention, Fort Collins, Colorado, USA (R. Nasci)
Main Article
Table
Primers used to sequence the PrM-E and NS5 genes of Nanjianyin virus*
Primers |
Primers sequence (5′ → 3′) |
PrM-E gene primers |
|
KFD1F(105-124) |
CGGACTGGTATTGATGCG |
KFD1R(1357-1340) |
TCTTCTCGGACTGCGTTG |
KFD2F(1100-1117) |
ACCAGGCGAGCACAGTCT |
KFD2R(1952-1935) |
CCTCCTCCAGTTGTTTCCA |
KFD3F(1652-1673) |
GAGTGCCCGTGGCTAACATAGA |
KFD3R(2832-2812) |
CTTGGTCCTCATTCCCATCCC |
NS5 gene primers |
|
FU1PM (8908-8933) |
TACAACATGATGGGVAARAGWGARAA |
cFD3 (9961-9983) |
AGCATGTCTTCCGTGGTCATCCA |
Main Article
Page created: December 08, 2010
Page updated: December 08, 2010
Page reviewed: December 08, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.