Volume 19, Number 11—November 2013
Dispatch
Tula Hantavirus Infection in Immunocompromised Host, Czech Republic
Table 2
Primers used in the study, Ostrava, Czech Republic, October 2012
Primer | Step | Target segment | Sequence (5′→ 3′) | Reference |
---|---|---|---|---|
HAN-L-F1 | 1st PCR | Large | ATGTAYGTBAGTGCWGATGC | (5) |
HAN-L-R1 | 1st PCR | Large | AACCADTCWGTYCCRTCATC | (5) |
HAN-L-F2 | 2nd PCR, sequencing | Large | TGCWGATGCHACIAARTGGTC | (5) |
HAN-L-R2 | 2nd PCR, sequencing | Large | GCRTCRTCWGARTGRTGDGCAA | (5) |
S1 | 1st PCR | Small | GGMCAGACAGCAGAYTGG | (6) |
S2 | 1st PCR | Small | AGCTCAGGATCCATRTCATC | (6) |
MaS4F | 2nd PCR, sequencing | Small | CATCACAGGSYTTGCACTTGCAAT | (7) |
MaS5C | 2nd PCR, sequencing | Small | TCCTGAGGCTGCAAGGTCAA | (7) |
References
- Plyusnin A, Vapalahti O, Lankinen H, Lehväslaiho H, Apekina N, Myasnikov Y, Tula virus: a newly detected hantavirus carried by European common voles. J Virol. 1994;68:7833–9.PubMedGoogle Scholar
- Schlegel M, Kindler E, Essbauer S, Wolf R, Thiel J, Groschup MH, Tula virus infections in the Eurasian water vole in Central Europe. Vector Borne Zoonotic Dis. 2012;12:503–13. DOIPubMedGoogle Scholar
- Heroldová M, Pejčoch M, Bryja J, Jánová E, Suchomel J, Tkadlec E. Tula virus in populations of small terrestrial mammals in a rural landscape. Vector Borne Zoonotic Dis. 2010;10:599–603.PubMedGoogle Scholar
- Heyman P, Ceianu CS, Christova I, Tordo N, Beersma M, Alves MJ, A five-year perspective on the situation of haemorrhagic fever with renal syndrome and status of the hantavirus reservoirs in Europe, 2005–2010. Euro Surveill. 2011;16. pii:19961. PubMedGoogle Scholar
- Klempa B, Fichet-Calvet E, Lecompte E, Auste B, Aniskin V, Meisel H, Hantavirus in African wood mouse, Guinea. Emerg Infect Dis. 2006;12:838–40. DOIPubMedGoogle Scholar
- Sibold C, Sparr S, Schulz A, Labuda M, Kozuch O, Lysý J, Genetic characterization of a new hantavirus detected in Microtus arvalis from Slovakia. Virus Genes. 1995;10:277–81. DOIPubMedGoogle Scholar
- Sibold C, Meisel H, Krüger DH, Labuda M, Lysy J, Kozuch O, Recombination in Tula hantavirus evolution: analysis of genetic lineages from Slovakia. J Virol. 1999;73:667–75.PubMedGoogle Scholar
- Vapalahti O, Lundkvist A, Kukkonen SKJ, Cheng Y, Gilljam M, Kanerva M, Isolation and characterization of Tula virus, a distinct serotype in the genus Hantavirus, family Bunyaviridae. J Gen Virol. 1996;77:3063–7. DOIPubMedGoogle Scholar
- Mertens M, Hofmann J, Petraityte-Burneikiene R, Ziller M, Sasnauskas K, Friedrich R, Seroprevalence study in forestry workers of a non-endemic region in eastern Germany reveals infections by Tula and Dobrava-Belgrade hantaviruses. Med Microbiol Immunol (Berl). 2011;200:263–8. DOIPubMedGoogle Scholar
- Schultze D, Lundkvist A, Blauenstein U, Heyman P. Tula virus infection associated with fever and exanthema after a wild rodent bite. Eur J Clin Microbiol Infect Dis. 2002;21:304–6. DOIPubMedGoogle Scholar
- Clement J, Frans J, Van Ranst M. Human Tula virus infection or rat-bite fever? Eur J Clin Microbiol Infect Dis. 2003;22:332–3.PubMedGoogle Scholar
- Klempa B, Meisel H, Räth S, Bartel J, Ulrich R, Krüger DH. Occurrence of renal and pulmonary syndrome in a region of northeast Germany where Tula hantavirus circulates. J Clin Microbiol. 2003;41:4894–7. DOIPubMedGoogle Scholar
1The authors contributed equally to this article.