Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 23, Number 12—December 2017
Dispatch

Identification of Dermacentor reticulatus Ticks Carrying Rickettsia raoultii on Migrating Jackal, Denmark

Kirstine Klitgaard, Mariann Chriél, Anastasia Isbrand, Tim K. Jensen, and René BødkerComments to Author 
Author affiliations: National Veterinary Institute, Lyngby, Denmark

Main Article

Table

Primers used for gene amplification and sequencing of Rickettsia spp. obtained from Dermacentor reticulatus ticks from a migrating jackal, Denmark

Primer name Primer sequence, 5′ → 3′ Target gene Length, bp Reference
120–2,788 AAACAATAATCAAGGTACTGT ompB 765 (5)
120–3,599
 TACTTCCGGTTACAGCAAAGT
Rr 190.70p ATGGCGAATATTTCTCCAAAA ompA 631 (4)
Rr190–701n
 GTTCCGTTAATGGCAGCATCT
RpCS877p GGGGACCTGCTCACGGCGG gltA 380 (4)
RpCS1258n ATTGCAAAAAGTACAGTGAACA

Main Article

References
  1. Andersen  LW, Harms  V, Caniglia  R, Czarnomska  SD, Fabbri  E, Jędrzejewska  B, et al. Long-distance dispersal of a wolf, Canis lupus, in northwestern Europe. Mammal Res. 2015;60:163–8. DOIGoogle Scholar
  2. Michelet  L, Delannoy  S, Devillers  E, Umhang  G, Aspan  A, Juremalm  M, et al. High-throughput screening of tick-borne pathogens in Europe. Front Cell Infect Microbiol. 2014;4:103. DOIPubMedGoogle Scholar
  3. Jensen  PM, Christoffersen  CS, Moutailler  S, Michelet  L, Klitgaard  K, Bødker  R. Transmission differentials for multiple pathogens as inferred from their prevalence in larva, nymph and adult of Ixodes ricinus (Acari: Ixodidae). Exp Appl Acarol. 2017;71:171–82. DOIPubMedGoogle Scholar
  4. Regnery  RL, Spruill  CL, Plikaytis  BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173:1576–89. DOIPubMedGoogle Scholar
  5. Roux  V, Fournier  PE, Raoult  D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol. 1996;34:2058–65.PubMedGoogle Scholar
  6. Mediannikov  O, Matsumoto  K, Samoylenko  I, Drancourt  M, Roux  V, Rydkina  E, et al. Rickettsia raoultii sp. nov., a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia. Int J Syst Evol Microbiol. 2008;58:1635–9. DOIPubMedGoogle Scholar
  7. Trouwborst  A, Krofel  M, Linnell  JDC. Legal implications of range expansions in a terrestrial carnivore: the case of the golden jackal (Canis aureus) in Europe. Biodivers Conserv. 2015;24:2593–610. DOIGoogle Scholar
  8. Földvári  G, Široký  P, Szekeres  S, Majoros  G, Sprong  H. Dermacentor reticulatus: a vector on the rise. Parasit Vectors. 2016;9:314. DOIPubMedGoogle Scholar
  9. Jongejan  F, Ringenier  M, Putting  M, Berger  L, Burgers  S, Kortekaas  R, et al. Novel foci of Dermacentor reticulatus ticks infected with Babesia canis and Babesia caballi in the Netherlands and in Belgium. Parasit Vectors. 2015;8:232. DOIPubMedGoogle Scholar
  10. Angelakis  E, Waton  J, Imbert  P, Socolovschi  C, Edouard  S, Dellamonica  P. Scalp eschar and neck lymphadenopathy caused by Bartonella henselae after tick bite. 2010;50:549–51.
  11. Dubourg  G, Socolovschi  C, Del Giudice  P, Fournier  PE, Raoult  D. Scalp eschar and neck lymphadenopathy after tick bite: an emerging syndrome with multiple causes. Eur J Clin Microbiol Infect Dis. 2014;33:1449–56. DOIPubMedGoogle Scholar
  12. Duscher  GG, Hodžić  A, Weiler  M, Vaux  AGC, Rudolf  I, Sixl  W, et al. First report of Rickettsia raoultii in field collected Dermacentor reticulatus ticks from Austria. Ticks Tick Borne Dis. 2016;7:720–2. DOIPubMedGoogle Scholar
  13. Rudolf  I, Venclíková  K, Blažejová  H, Betášová  L, Mendel  J, Hubálek  Z, et al. First report of Rickettsia raoultii and Rickettsia helvetica in Dermacentor reticulatus ticks from the Czech Republic. Ticks Tick Borne Dis. 2016;7:1222–4. DOIPubMedGoogle Scholar
  14. Szekeres  S, Docters van Leeuwen  A, Rigó  K, Jablonszky  M, Majoros  G, Sprong  H, et al. Prevalence and diversity of human pathogenic rickettsiae in urban versus rural habitats, Hungary. Exp Appl Acarol. 2016;68:223–6. DOIPubMedGoogle Scholar
  15. Socolovschi  C, Mediannikov  O, Raoult  D, Parola  P. Update on tick-borne bacterial diseases in Europe. Parasite. 2009;16:259–73. DOIPubMedGoogle Scholar

Main Article

Page created: November 16, 2017
Page updated: November 16, 2017
Page reviewed: November 16, 2017
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external