Volume 24, Number 12—December 2018
Dispatch
Using PCR-Based Sequencing to Diagnose Haycocknema perplexum Infection in Human Myositis Case, Australia
Table 1
Primer sequences for nested PCR to detect Haycocknema perplexum nematodes using partial regions of the cox-1 gene and the SSU gene*
Designation | Primer pair | Oligonucleotide sequence, 5′ → 3′ | Annealing temperature, °C | Expected size, bp | Reference |
---|---|---|---|---|---|
cox-1 | |||||
1° PCR | RhigoCoxF | TTTTTTGGACATCCTGAGGTGTAT | (3) | ||
RhigoCoxR | CAGACTCAACACATAATGAAAATG | 47 | 450 | (3) | |
2° PCR | HPCO1F | GGACATCCTGAGGTGTATAT | This study | ||
HPCO1R |
AATGAAAATGTCCTACCACA |
50 |
400 |
This study |
|
SSU | |||||
1° PCR | Nem18sF | CGCGAATRGCTCATTACAACAGC | (1) | ||
1912R | TTTACGGTCAGAACTAGGG | 54 | 900 | (2) | |
2° PCR | 1096F | GGTAATTCTGGAGCTAATAC | (2) | ||
Nem18sR | GGGCGGTATCTGATCGCC | 54 | 830 | (1) |
*All PCR used 35 cycles with initial extension of 5 min. All cycles were 30 s except that SSU had a 1 min extension for PCRs. cox-1, cytochrome c oxidase 1; SSU, small subunit of nuclear ribosomal RNA.
References
- Floyd RM, Rogers AD, Lambshead PJD, Smith CR. Nematode-specific PCR primers for the 18S small subunit rRNA gene. Mol Ecol Notes. 2005;5:611–2. DOIGoogle Scholar
- Holterman M, van der Wurff A, van den Elsen S, van Megen H, Bongers T, Holovachov O, et al. Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown Clades. Mol Biol Evol. 2006;23:1792–800. DOIPubMedGoogle Scholar
- Koehler AV, Spratt DM, Norton R, Warren S, McEwan B, Urkude R, et al. More parasitic myositis cases in humans in Australia, and the definition of genetic markers for the causative agents as a basis for molecular diagnosis. Infect Genet Evol. 2016;44:69–75. DOIPubMedGoogle Scholar
- Dennett X, Siejka SJ, Andrews JR, Beveridge I, Spratt DM. Polymyositis caused by a new genus of nematode. Med J Aust. 1998;168:226–7.PubMedGoogle Scholar
- Spratt DM. Australian ecosystems, capricious food chains and parasitic consequences for people. Int J Parasitol. 2005;35:717–24. DOIPubMedGoogle Scholar
- Spratt DM, Beveridge I, Andrews JR, Dennett X. Haycocknema perplexum n. g., n. sp. (Nematoda: Robertdollfusidae): an intramyofibre parasite in man. Syst Parasitol. 1999;43:123–31. DOIPubMedGoogle Scholar
- Basuroy R, Pennisi R, Robertson T, Norton R, Stokes J, Reimers J, et al. Parasitic myositis in tropical Australia. Med J Aust. 2008;188:254–6.PubMedGoogle Scholar
- McKelvie P, Reardon K, Bond K, Spratt DM, Gangell A, Zochling J, et al. A further patient with parasitic myositis due to Haycocknema perplexum, a rare entity. J Clin Neurosci. 2013;20:1019–22. DOIPubMedGoogle Scholar
- Vos LJ, Robertson T, Binotto E. Haycocknema perplexum: an emerging cause of parasitic myositis in Australia. Commun Dis Intell Q Rep. 2016;40:E496–9.PubMedGoogle Scholar
- Andrews JR, Ainsworth R, Abernethy D. Trichinella pseudospiralis in humans: description of a case and its treatment. Trans R Soc Trop Med Hyg. 1994;88:200–3. DOIPubMedGoogle Scholar