Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 24, Number 2—February 2018
Research

Plasmid-Encoded Transferable mecB-Mediated Methicillin Resistance in Staphylococcus aureus

Karsten BeckerComments to Author , Sarah van Alen, Evgeny A. Idelevich, Nina Schleimer, Jochen Seggewiß, Alexander Mellmann, Ursula Kaspar, and Georg Peters
Author affiliations: University Hospital Münster, Münster, Germany (K. Becker, S. van Alen, E.A. Idelevich, N. Schleimer, J. Seggewiß, A. Mellmann, U. Kaspar, G. Peters); Cells in Motion, Münster (G. Peters)

Main Article

Table 1

Oligonucleotides used in study of methicillin resistance genes in Staphylococcus aureus

Gene Oligonucleotide Nucleotide sequence, 5′ → 3′ Melting temperature Source
mecA
 mec5 AAAATCGATGGTAAAGGTTGGC 55.5°C
 (29)
mec6
 AGTTCTGCAGTACCGGATTTGC
mecC
 mecAL3 TCAAATTGAGTTTTTCCATTATCA 59.3°C
 This study
mecAL4
 AACTTGGTTATTCAAAGATGACGA
mecB mecB-for TTAACATATACACCCGCTTG 57°C This study
mecB-rev TAAAGTTCATTAGGCACCTCC

Main Article

References
  1. de Kraker  ME, Davey  PG, Grundmann  H; BURDEN study group. Mortality and hospital stay associated with resistant Staphylococcus aureus and Escherichia coli bacteremia: estimating the burden of antibiotic resistance in Europe. PLoS Med. 2011;8:e1001104. DOIPubMedGoogle Scholar
  2. Lee  BY, Singh  A, David  MZ, Bartsch  SM, Slayton  RB, Huang  SS, et al. The economic burden of community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA). Clin Microbiol Infect. 2013;19:528–36. DOIPubMedGoogle Scholar
  3. Becker  K, Heilmann  C, Peters  G. Coagulase-negative staphylococci. Clin Microbiol Rev. 2014;27:870–926. DOIPubMedGoogle Scholar
  4. Tong  SY, Davis  JS, Eichenberger  E, Holland  TL, Fowler  VG Jr. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev. 2015;28:603–61. DOIPubMedGoogle Scholar
  5. Johnson  AP. Methicillin-resistant Staphylococcus aureus: the European landscape. J Antimicrob Chemother. 2011;66(Suppl 4):iv43–8. DOIPubMedGoogle Scholar
  6. Chambers  HF, Deleo  FR. Waves of resistance: Staphylococcus aureus in the antibiotic era. Nat Rev Microbiol. 2009;7:629–41. DOIPubMedGoogle Scholar
  7. Harris  SR, Feil  EJ, Holden  MT, Quail  MA, Nickerson  EK, Chantratita  N, et al. Evolution of MRSA during hospital transmission and intercontinental spread. Science. 2010;327:469–74. DOIPubMedGoogle Scholar
  8. Becker  K, Ballhausen  B, Kahl  BC, Köck  R. The clinical impact of livestock-associated methicillin-resistant Staphylococcus aureus of the clonal complex 398 for humans. Vet Microbiol. 2017;200:33–8. DOIPubMedGoogle Scholar
  9. Jevons  MP. “Celbenin”-resistant staphylococci. BMJ. 1961;1:124–5. DOIGoogle Scholar
  10. Peacock  SJ, Paterson  GK. Mechanisms of methicillin resistance in Staphylococcus aureus. Annu Rev Biochem. 2015;84:577–601. DOIPubMedGoogle Scholar
  11. Becker  K, Ballhausen  B, Köck  R, Kriegeskorte  A. Methicillin resistance in Staphylococcus isolates: the “mec alphabet” with specific consideration of mecC, a mec homolog associated with zoonotic S. aureus lineages. Int J Med Microbiol. 2014;304:794–804. DOIPubMedGoogle Scholar
  12. Shore  AC, Deasy  EC, Slickers  P, Brennan  G, O’Connell  B, Monecke  S, et al. Detection of staphylococcal cassette chromosome mec type XI carrying highly divergent mecA, mecI, mecR1, blaZ, and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2011;55:3765–73. DOIPubMedGoogle Scholar
  13. García-Álvarez  L, Holden  MT, Lindsay  H, Webb  CR, Brown  DF, Curran  MD, et al. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study. Lancet Infect Dis. 2011;11:595–603. DOIPubMedGoogle Scholar
  14. Beck  WD, Berger-Bächi  B, Kayser  FH. Additional DNA in methicillin-resistant Staphylococcus aureus and molecular cloning of mec-specific DNA. J Bacteriol. 1986;165:373–8. DOIPubMedGoogle Scholar
  15. Baba  T, Kuwahara-Arai  K, Uchiyama  I, Takeuchi  F, Ito  T, Hiramatsu  K. Complete genome sequence of Macrococcus caseolyticus strain JCSCS5402, [corrected] reflecting the ancestral genome of the human-pathogenic staphylococci. J Bacteriol. 2009;191:1180–90. DOIPubMedGoogle Scholar
  16. Tsubakishita  S, Kuwahara-Arai  K, Baba  T, Hiramatsu  K. Staphylococcal cassette chromosome mec-like element in Macrococcus caseolyticus. Antimicrob Agents Chemother. 2010;54:1469–75. DOIPubMedGoogle Scholar
  17. Schwendener  S, Cotting  K, Perreten  V. Novel methicillin resistance gene mecD in clinical Macrococcus caseolyticus strains from bovine and canine sources. Sci Rep. 2017;7:43797. DOIPubMedGoogle Scholar
  18. Köck  R, Werner  P, Friedrich  AW, Fegeler  C, Becker  K, Bindewald  O, et al.; Prevalence of Multiresistant Microorganisms (PMM) Study Group; Prevalence of Multiresistant Microorganisms PMM Study Group. Persistence of nasal colonization with human pathogenic bacteria and associated antimicrobial resistance in the German general population. New Microbes New Infect. 2015;9:24–34. DOIPubMedGoogle Scholar
  19. Lowy  FD. Antimicrobial resistance: the example of Staphylococcus aureus. J Clin Invest. 2003;111:1265–73. DOIPubMedGoogle Scholar
  20. Stojanov  M, Moreillon  P, Sakwinska  O. Excision of staphylococcal cassette chromosome mec in methicillin-resistant Staphylococcus aureus assessed by quantitative PCR. BMC Res Notes. 2015;8:828. DOIPubMedGoogle Scholar
  21. Borg  MA, Hulscher  M, Scicluna  EA, Richards  J, Azanowsky  JM, Xuereb  D, et al. Prevention of meticillin-resistant Staphylococcus aureus bloodstream infections in European hospitals: moving beyond policies. J Hosp Infect. 2014;87:203–11. DOIPubMedGoogle Scholar
  22. Jurke  A, Köck  R, Becker  K, Thole  S, Hendrix  R, Rossen  J, et al. Reduction of the nosocomial meticillin-resistant Staphylococcus aureus incidence density by a region-wide search and follow-strategy in forty German hospitals of the EUREGIO, 2009 to 2011. Euro Surveill. 2013;18:20579. DOIPubMedGoogle Scholar
  23. Liu  P, Wu  Z, Xue  H, Zhao  X. Antibiotics trigger initiation of SCCmec transfer by inducing SOS responses. Nucleic Acids Res. 2017;45:3944–52. DOIPubMedGoogle Scholar
  24. Humphreys  H, Becker  K, Dohmen  PM, Petrosillo  N, Spencer  M, van Rijen  M, et al. Staphylococcus aureus and surgical site infections: benefits of screening and decolonization before surgery. J Hosp Infect. 2016;94:295–304. DOIPubMedGoogle Scholar
  25. Mellmann  A, Friedrich  AW, Rosenkötter  N, Rothgänger  J, Karch  H, Reintjes  R, et al. Automated DNA sequence-based early warning system for the detection of methicillin-resistant Staphylococcus aureus outbreaks. PLoS Med. 2006;3:e33. DOIPubMedGoogle Scholar
  26. Enright  MC, Day  NP, Davies  CE, Peacock  SJ, Spratt  BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38:1008–15.PubMedGoogle Scholar
  27. Becker  K, Pagnier  I, Schuhen  B, Wenzelburger  F, Friedrich  AW, Kipp  F, et al. Does nasal cocolonization by methicillin-resistant coagulase-negative staphylococci and methicillin-susceptible Staphylococcus aureus strains occur frequently enough to represent a risk of false-positive methicillin-resistant S. aureus determinations by molecular methods? J Clin Microbiol. 2006;44:229–31. DOIPubMedGoogle Scholar
  28. Kriegeskorte  A, Ballhausen  B, Idelevich  EA, Köck  R, Friedrich  AW, Karch  H, et al. Human MRSA isolates with novel genetic homolog, Germany. Emerg Infect Dis. 2012;18:1016–8. DOIPubMedGoogle Scholar
  29. Sullivan  MJ, Petty  NK, Beatson  SA. Easyfig: a genome comparison visualizer. Bioinformatics. 2011;27:1009–10. DOIPubMedGoogle Scholar
  30. Peters  G, Becker  K. Epidemiology, control and treatment of methicillin-resistant Staphylococcus aureus. Drugs. 1996;52(Suppl 2):50–4. DOIPubMedGoogle Scholar
  31. Idelevich  EA, Schaumburg  F, Knaack  D, Scherzinger  AS, Mutter  W, Peters  G, et al. The recombinant bacteriophage endolysin HY-133 exhibits in vitro activity against different african clonal lineages of the Staphylococcus aureus complex, including Staphylococcus schweitzeri. Antimicrob Agents Chemother. 2016;60:2551–3. DOIPubMedGoogle Scholar
  32. Idelevich  EA, von Eiff  C, Friedrich  AW, Iannelli  D, Xia  G, Peters  G, et al. In vitro activity against Staphylococcus aureus of a novel antimicrobial agent, PRF-119, a recombinant chimeric bacteriophage endolysin. Antimicrob Agents Chemother. 2011;55:4416–9. DOIPubMedGoogle Scholar
  33. Meyer  F, Goesmann  A, McHardy  AC, Bartels  D, Bekel  T, Clausen  J, et al. GenDB—an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 2003;31:2187–95. DOIPubMedGoogle Scholar
  34. Zhang  Z, Schwartz  S, Wagner  L, Miller  W. A greedy algorithm for aligning DNA sequences. J Comput Biol. 2000;7:203–14. DOIPubMedGoogle Scholar
  35. Nübel  U, Roumagnac  P, Feldkamp  M, Song  JH, Ko  KS, Huang  YC, et al. Frequent emergence and limited geographic dispersal of methicillin-resistant Staphylococcus aureus. Proc Natl Acad Sci U S A. 2008;105:14130–5. DOIPubMedGoogle Scholar
  36. Becker  K, Schaumburg  F, Fegeler  C, Friedrich  AW, Köck  R; Prevalence of Multiresistant Microorganisms PMM Study. Staphylococcus aureus from the German general population is highly diverse. Int J Med Microbiol. 2017;307:21–7. DOIPubMedGoogle Scholar
  37. Monecke  S, Coombs  G, Shore  AC, Coleman  DC, Akpaka  P, Borg  M, et al. A field guide to pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS One. 2011;6:e17936. DOIPubMedGoogle Scholar
  38. Lanza  VF, Tedim  AP, Martínez  JL, Baquero  F, Coque  TM. The plasmidome of Firmicutes: impact on the emergence and the spread of resistance to antimicrobials. Microbiol Spectr. 2015;3:PLAS-0039–2014.
  39. Gómez-Sanz  E, Schwendener  S, Thomann  A, Gobeli Brawand  S, Perreten  V. First staphylococcal cassette chromosome mec containing a mecB-carrying gene complex independent of transposon Tn6045 in a Macrococcus caseolyticus isolate from a canine infection. Antimicrob Agents Chemother. 2015;59:4577–83. DOIPubMedGoogle Scholar
  40. Harrison  EM, Paterson  GK, Holden  MT, Larsen  J, Stegger  M, Larsen  AR, et al. Whole genome sequencing identifies zoonotic transmission of MRSA isolates with the novel mecA homologue mecC. EMBO Mol Med. 2013;5:509–15. DOIPubMedGoogle Scholar
  41. Larsen  J, Clasen  J, Hansen  JE, Paulander  W, Petersen  A, Larsen  AR, et al. Copresence of tet(K) and tet(M) in livestock-associated methicillin-resistant Staphylococcus aureus clonal complex 398 is associated with increased fitness during exposure to sublethal concentrations of tetracycline. Antimicrob Agents Chemother. 2016;60:4401–3. DOIPubMedGoogle Scholar
  42. Ramsay  JP, Kwong  SM, Murphy  RJ, Yui Eto  K, Price  KJ, Nguyen  QT, et al. An updated view of plasmid conjugation and mobilization in Staphylococcus. Mob Genet Elements. 2016;6:e1208317. DOIPubMedGoogle Scholar
  43. McCarthy  AJ, Lindsay  JA. The distribution of plasmids that carry virulence and resistance genes in Staphylococcus aureus is lineage associated. BMC Microbiol. 2012;12:104. DOIPubMedGoogle Scholar
  44. Shearer  JE, Wireman  J, Hostetler  J, Forberger  H, Borman  J, Gill  J, et al. Major families of multiresistant plasmids from geographically and epidemiologically diverse staphylococci. G3 (Bethesda). 2011;1:581–91. DOIPubMedGoogle Scholar
  45. Chan  LC, Basuino  L, Diep  B, Hamilton  S, Chatterjee  SS, Chambers  HF. Ceftobiprole- and ceftaroline-resistant methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2015;59:2960–3. DOIPubMedGoogle Scholar
  46. Schaumburg  F, Peters  G, Alabi  A, Becker  K, Idelevich  EA. Missense mutations of PBP2a are associated with reduced susceptibility to ceftaroline and ceftobiprole in African MRSA. J Antimicrob Chemother. 2016;71:41–4. DOIPubMedGoogle Scholar
  47. Farrell  DJ, Castanheira  M, Mendes  RE, Sader  HS, Jones  RN. In vitro activity of ceftaroline against multidrug-resistant Staphylococcus aureus and Streptococcus pneumoniae: a review of published studies and the AWARE Surveillance Program (2008-2010). Clin Infect Dis. 2012;55(Suppl 3):S206–14. DOIPubMedGoogle Scholar
  48. Zhang  H, Xiao  M, Kong  F, O’Sullivan  MV, Mao  LL, Zhao  HR, et al. A multicentre study of meticillin-resistant Staphylococcus aureus in acute bacterial skin and skin-structure infections in China: susceptibility to ceftaroline and molecular epidemiology. Int J Antimicrob Agents. 2015;45:347–50. DOIPubMedGoogle Scholar
  49. Murakami  K, Minamide  W, Wada  K, Nakamura  E, Teraoka  H, Watanabe  S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol. 1991;29:2240–4.PubMedGoogle Scholar

Main Article

Page created: January 17, 2018
Page updated: January 17, 2018
Page reviewed: January 17, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external