Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 24, Number 2—February 2018
Research

Macacine Herpesvirus 1 Antibody Prevalence and DNA Shedding among Invasive Rhesus Macaques, Silver Springs State Park, Florida, USA

Samantha M. WiselyComments to Author , Katherine A. Sayler, C. Jane Anderson, Carisa L. Boyce, Amy R. Klegarth, and Steve A. Johnson
Author affiliations: University of Florida, Gainesville, Florida, USA (S.M. Wisely, K.A. Sayler, C.J. Anderson, C.L. Boyce, S.A. Johnson); University of Washington, Seattle, Washington, USA (A.R. Klegarth)

Main Article

Table 1

PCR oligonucleotide primers and probe used in the detection of McHV-1 viral DNA in samples from rhesus macaques and soil, Silver Springs State Park, Florida, USA, 2000–2012*

PCR target Reference Sequence, 5′ → 3′
gGBV-323F (21) TGGCCTACTACCGCGTGG
gGBV-446R (21) TGGTACGTGTGGGAGTCGCG
gGBV-403T (21) (6-FAM)CCGCCCTCTCCGAGCACGTG(BHQ-1)
DFA (22) GAYTTYGCNAGYYTNTAYCC
ILK (22) TCCTGGACAAGCAGCARNYSGCNMTNAA
KG1 (22) GTCTTGCTCACCAGNTCNACNCCYTT
TGV (22) TGTAACTCGGTGTAYGGNTTYACNGGNGT
IYG (22) CACAGAGTCCGTRTCNCCRTADAT
HB2A (8) CCGCGCTCGCCACGGACACCA
HB2B (8) ATCGCGCGCCGGACCGATCGT
AS9 (23) TC[A/T]CCCGGGCTAGACTT[T/C][A/C]TCTTCCTGCTCAG
AS2 (23) ATGGCGGCCAGGGTCAGCGCGCAGAGG
AS8 (23) CTCTGCGCGCTGACCCTGGCCGCCATGG
AS7 (23) CACGTCGGGGGG[G/A]TCCGTCTTCTGCTCC

*BHQ-1, black hole quencher 1; 6-FAM, 6-fluorescein amidite; gG, glycoprotein G; McHV-1, macacine herpesvirus 1.

Main Article

References
  1. Pedersen  AB, Davies  TJ. Cross-species pathogen transmission and disease emergence in primates. EcoHealth. 2009;6:496–508. DOIPubMedGoogle Scholar
  2. Kairo  M, Ali  B, Cheesman  O, Haysom  K, Murphy  S. Invasive species threats in the Caribbean region: report to the Nature Conservancy. Curepe (Trinidad and Tobago): CAB International; 2003.
  3. Anderson  CJ, Hostetler  ME, Johnson  SA. History and status of introduced non-human primate populations in Florida. Southeast Nat. 2017;16:19–36. DOIGoogle Scholar
  4. Hannibal  DL, Bliss-Moreau  E, Vandeleest  J, McCowan  B, Capitanio  J. Laboratory rhesus macaque social housing and social changes: Implications for research. Am J Primatol. 2017;79:1–14. DOIPubMedGoogle Scholar
  5. Centers for Disease Control and Prevention. B virus (herpes B, monkey B virus, herpesvirus simiae, and herpesvirus B). Atlanta: The Centers; 2016 [cited 2017 Aug 14]. https://www.cdc.gov/herpesbvirus/index.html
  6. Holmes  GP, Chapman  LE, Stewart  JA, Straus  SE, Hilliard  JK, Davenport  DS; the B Virus Working Group. Guidelines for the prevention and treatment of B-virus infections in exposed persons. The B virus Working Group. Clin Infect Dis. 1995;20:421–39. DOIPubMedGoogle Scholar
  7. Pellett  P, Roizman  B. The family Herpesviridae: a brief introduction. In: Knipe D and Howley P, editors. Fields virology, 6th ed. Philadelphia: Lippincott Williams and Wilkins; 2013. p. 1802–2.
  8. Oya  C, Ochiai  Y, Taniuchi  Y, Takano  T, Fujima  A, Ueda  F, et al. Prevalence of herpes B virus genome in the trigeminal ganglia of seropositive cynomolgus macaques. Lab Anim. 2008;42:99–103. DOIPubMedGoogle Scholar
  9. Engel  GA, Jones-Engel  L, Schillaci  MA, Suaryana  KG, Putra  A, Fuentes  A, et al. Human exposure to herpesvirus B-seropositive macaques, Bali, Indonesia. Emerg Infect Dis. 2002;8:789–95. DOIPubMedGoogle Scholar
  10. Jensen  K, Alvarado-Ramy  F, González-Martínez  J, Kraiselburd  E, Rullán  J. B-virus and free-ranging macaques, Puerto Rico. Emerg Infect Dis. 2004;10:494–6. DOIPubMedGoogle Scholar
  11. Jones-Engel  L, Engel  GA, Heidrich  J, Chalise  M, Poudel  N, Viscidi  R, et al. Temple monkeys and health implications of commensalism, Kathmandu, Nepal. Emerg Infect Dis. 2006;12:900–6. DOIPubMedGoogle Scholar
  12. Tischer  BK, Osterrieder  N. Herpesviruses—a zoonotic threat? Vet Microbiol. 2010;140:266–70. DOIPubMedGoogle Scholar
  13. Lee  MH, Rostal  MK, Hughes  T, Sitam  F, Lee  CY, Japning  J, et al. Macacine herpesvirus 1 in long-tailed macaques, Malaysia, 2009–2011. Emerg Infect Dis. 2015;21:1107–13. DOIPubMedGoogle Scholar
  14. Anderson  CJ, Hostetler  ME, Sieving  KE, Johnson  SA. Predation of artificial nests by introduced rhesus macaques (Macaca mulatta) in Florida, USA. Biol Invasions. 2016;18:2783–9. DOIGoogle Scholar
  15. Wolfe  LD, Peters  EH. History of the freeranging rhesus monkeys (Macaca mulatta) of Silver Springs. Fla Sci. 1987;50:234–45.
  16. Wolfe  LD. Rhesus macaques: a comparative study of two sites, Jaipur, India, and Silver Springs, Florida. In: Fuentes A, Wolfe LD, editors. Primates face to face: the conservation implications of human-nonhuman primate interconnections. Cambridge: Cambridge University Press; 2002. p. 310–30.
  17. Montague  CL, Colwell  SV, Percival  HF, Gottgens  JF. Issues and options related to management of Silver Springs rhesus macaques. Report no. 49. Tallahassee (FL): Florida Game and Fresh Water Fish Commission; 1994.
  18. Burgos-Rodriguez  AG. Zoonotic diseases of primates. Vet Clin North Am Exot Anim Pract. 2011;14:557–75, viii. DOIPubMedGoogle Scholar
  19. Anderson  CJ. Ecology and impacts of introduced non-human primate populations in Florida [dissertation]. Gainesville (FL): University of Florida. In press.
  20. Weigler  BJ. Biology of B virus in macaque and human hosts: a review. Clin Infect Dis. 1992;14:555–67. DOIPubMedGoogle Scholar
  21. Brown  LD, Cai  TT, DasGupta  A. Interval estimation for a binomial proportion. Stat Sci. 2001;16:101–33. DOIGoogle Scholar
  22. Perelygina  L, Patrusheva  I, Manes  N, Wildes  MJ, Krug  P, Hilliard  JK. Quantitative real-time PCR for detection of monkey B virus (Cercopithecine herpesvirus 1) in clinical samples. J Virol Methods. 2003;109:245–51. DOIPubMedGoogle Scholar
  23. VanDevanter  DR, Warrener  P, Bennett  L, Schultz  ER, Coulter  S, Garber  RL, et al. Detection and analysis of diverse herpesviral species by consensus primer PCR. J Clin Microbiol. 1996;34:1666–71.PubMedGoogle Scholar
  24. Smith  AL, Black  DH, Eberle  R. Molecular evidence for distinct genotypes of monkey B virus (herpesvirus simiae) which are related to the macaque host species. J Virol. 1998;72:9224–32.PubMedGoogle Scholar
  25. Nei  M, Kumar  S. Molecular evolution and phylogenetics. New York: Oxford University Press; 2000.
  26. Weigler  BJ, Roberts  JA, Hird  DW, Lerche  NW, Hilliard  JK. A cross sectional survey for B virus antibody in a colony of group housed rhesus macaques. Lab Anim Sci. 1990;40:257–61.PubMedGoogle Scholar
  27. Weigler  BJ, Hird  DW, Hilliard  JK, Lerche  NW, Roberts  JA, Scott  LM, et al. Epidemiology of cercopithecine herpesvirus 1 (B virus) infection and shedding in a large breeding cohort of rhesus macaques. J Infect Dis. 1993;167:257–63. DOIPubMedGoogle Scholar
  28. Elmore  D, Eberle  R. Monkey B virus (Cercopithecine herpesvirus 1). Comp Med. 2008;58:11–21.PubMedGoogle Scholar
  29. Eberle  R, Maxwell  LK, Nicholson  S, Black  D, Jones-Engel  L. Genome sequence variation among isolates of monkey B virus (Macacine alphaherpesvirus 1) from captive macaques. Virology. 2017;508:26–35. DOIPubMedGoogle Scholar
  30. Maestripieri  D. Rhesus macaques. In: Breed MD and Moore J, editors. Encyclopedia of animal behavior, vol. 3. San Diego (CA): Elsevier Science; 2010. p. 70–4.
  31. Fooden  J. Systematic review of the rhesus macaque, Macaca mulatta (Zimmermann, 1780). Chicago: Field Museum of Natural History; 2000.
  32. Riley  EP, Wade  TW. Adapting to Florida’s riverine woodlands: the population status and feeding ecology of the Silver River rhesus macaques and their interface with humans. Primates. 2016;57:195–210. DOIPubMedGoogle Scholar
  33. Sha  JCM, Gumert  MD, Lee  BPY-H, Fuentes  A, Rajathurai  S, Chan  S, et al. Status of the long-tailed macaque Macaca fascicularis in Singapore and implications for management. Biodivers Conserv. 2009;18:2909–26. DOIGoogle Scholar
  34. Aubert  M, Chen  Z, Lang  R, Dang  CH, Fowler  C, Sloan  DD, et al. The antiapoptotic herpes simplex virus glycoprotein J localizes to multiple cellular organelles and induces reactive oxygen species formation. J Virol. 2008;82:617–29. DOIPubMedGoogle Scholar
  35. Scinicariello  F, Eberle  R, Hilliard  JK. Rapid detection of B virus (herpesvirus simiae) DNA by polymerase chain reaction. J Infect Dis. 1993;168:747–50. DOIPubMedGoogle Scholar
  36. Reinhardt  V. Common husbandry-related variables in biomedical research with animals. Lab Anim. 2004;38:213–35. DOIPubMedGoogle Scholar
  37. Freifeld  AG, Hilliard  J, Southers  J, Murray  M, Savarese  B, Schmitt  JM, et al. A controlled seroprevalence survey of primate handlers for evidence of asymptomatic herpes B virus infection. J Infect Dis. 1995;171:1031–4. DOIPubMedGoogle Scholar
  38. Ostrowski  SR, Leslie  MJ, Parrott  T, Abelt  S, Piercy  PE. B-virus from pet macaque monkeys: an emerging threat in the United States? Emerg Infect Dis. 1998;4:117–21. DOIPubMedGoogle Scholar
  39. Misra  UK, Tan  CT, Kalita  J. Viral encephalitis and epilepsy. Epilepsia. 2008;49(Suppl 6):13–8. DOIPubMedGoogle Scholar
  40. Belay  ED, Monroe  SS. Low-incidence, high-consequence pathogens. Emerg Infect Dis. 2014;20:319–21. DOIPubMedGoogle Scholar

Main Article

Page created: January 17, 2018
Page updated: January 17, 2018
Page reviewed: January 17, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external