Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 25, Number 11—November 2019
Research Letter

Human Case of Ehrlichia chaffeensis Infection, Taiwan

Shih-Huan Peng, Su-Lin Yang, Yu-Ni Ho, Hsiang-Fei Chen, and Pei-Yun ShuComments to Author 
Author affiliations: Centers for Disease Control, Taipei, Taiwan (S.-H. Peng, S.-L. Yang, H.-F. Chen, P.-Y. Shu); Chang Gung Memorial Hospital–Kaohsiung Medical Center, Kaohsiung, Taiwan (Y.-N. Ho)

Cite This Article


In 2018, an immunosuppressed woman in southern Taiwan had onset of fever, chills, myalgia, malaise, thrombocytopenia, lymphocytopenia, and elevated hepatic transaminases. Investigation revealed infection with Ehrlichia chaffeensis. This autochthonous case of human monocytotropic ehrlichiosis was confirmed by PCR, DNA sequencing, and seroconversion.

Human monocytic ehrlichiosis (HME) is an acute, febrile, tickborne disease caused by the bacterium Ehrlichia chaffeensis. HME was first reported in the United States in 1986 (1), and >1,000 ehrlichiosis cases have been reported annually since 2012 ( In Asia, however, only a limited number of HME cases have been reported in 3 countries (Thailand, South Korea, and China) (24).

Clinical manifestations of HME range from mild febrile illness to severe multiple organ failure. The most common symptoms of HME are fever, headache, myalgia, malaise, nausea, vomiting, diarrhea, and abdominal pain (57), which are difficult to differentiate from the symptoms of other febrile infectious diseases. Therefore, HME must be confirmed by laboratory diagnosis.

Although HME has not been documented in Taiwan, serologic evidence of Ehrlichia spp. has been detected in small mammals, such as Rattus norvegicus, R. losea, and Bandicota indica rats that are found around international and local harbors (8). In addition, Haemaphysalis flava ticks infected with Ehrlichia spp. have been collected from pale thrush birds (Turdus pallidus) and identified in Taiwan (9). We report an autochthonous human case of E. chaffeensis infection in Taiwan.

In mid-July 2018, a 66-year-old woman living in the Namaxia District of Kaohsiung City in southern Taiwan was admitted to Kaohsiung Chang Gung Memorial Hospital with a 5-day history of intermittent fever (39.8°C), chills, myalgias, malaise, mild dyspnea, and diffuse abdominal pain. The patient had underlying hypertension, type 2 diabetes mellitus, alcoholic fatty liver, and gastroesophageal reflux disease. Laboratory examinations at admission showed that the patient had thrombocytopenia; lymphocytopenia; elevated levels of C-reactive protein, aspartate aminotransferase, alanine aminotransferase, and creatinine; and an increased number of polymorphonuclear leukocytes (Table). Whole blood counts were within reference ranges, and no leukocytopenia was observed. A chest radiograph showed mild infiltration over the bilateral lower lung fields. Laboratory tests for dengue, influenza A and B, hepatitis A, hepatitis B, and hepatitis C viruses were all negative. She was admitted under the impression of atypical infection and thrombocytopenia.

The patient is a coffee farmer who lives in a rural region in Kaohsiung. Although she claimed not to have received arthropod or animal bites, small mammals and birds had often been seen around her workplace and house. Therefore, arthropodborne rickettsial diseases were suspected, and oral doxycycline (100 mg every 12 h) for 4 days and intravenous ceftriaxone (1 g every 12 h) for 7 days were prescribed as empirical therapy on the patient’s first day at the hospital. Because ehrlichial infection had not been confirmed during hospitalization, the patient was discharged with a prescription (500 mg cefadroxil monohydrate every 12 h) to be taken for 5 days because of suspicion of atypical bacterial infection.

Blood specimens collected from the patient on day 6 (acute-phase specimens) and day 20 (convalescent-phase specimens) after illness onset were sent to the Taiwan Centers for Disease Control (Taipei, Taiwan) for laboratory diagnosis of zoonotic diseases. DNA extracted from acute-phase blood specimens using the QIAamp DNA blood Mini Kit (QIAGEN GmbH, was used to detect Ehrlichia chaffeensis infection using a primer set targeting ehrlichial 16S rRNA gene (forward primer: AGCGGCTATCTGGTTCGA; reverse primer: CATGCTCCACCGCTTGTG) and an E. chaffeensis–specific primer set targeting the nitrogen assimilation regulatory protein (ntrX) gene (forward primer: TGCCGGTAGATATAGTATCGA; reverse primer: ATTTGCGATGAAGTGCGG) by QuantiNova SYBR green real-time PCR (QIAGEN). The PCR products of 16S rRNA (182 bp; GenBank accession no. MN088851) and the ntrX gene sequence (153 bp; GenBank accession no. MN096569) were determined and analyzed. The sequence was 100% homologous with the sequences of E. chaffeensis strains, including the Arkansas, Jax, Saint Vincent, West Paces, Wakulla, Osceola, Liberty, and Heartland strains. The PCR results were negative for Coxiella burnetii, Orientia tsutsugamushi, typhus group rickettsiae, spotted fever group rickettsiae, and Anaplasma phagocytophilum (Appendix Table). Paired (acute- and convalescent-phase) serum samples were used to detect antibodies against E. chaffeensis by using indirect immunofluorescence assay according to the manufacturer’s recommendation (Focus Diagnostics, IgG against E. chaffeensis showed seroconversion (titers ranging from <1:16 to 1:256) of the paired serum samples. IgG against Coxiella burnetii, Orientia tsutsugamushi, typhus group rickettsiae, spotted fever group rickettsiae, and Anaplasma phagocytophilum were all negative. The results of the microscopic agglutination test and the isolation of Leptospira sp. were also negative.

The presence of an HME case highlights the need for further studies of the prevalence, geographic distribution, and control of this disease in Taiwan. Human monocytic ehrlichiosis patients with immunosuppressive conditions, such as diabetes, might have a higher risk for hospitalization and life-threatening complications (10). In this case, the suspicion of rickettsial infection was based on the patient’s potential exposure to arthropodborne pathogens at her workplace and home, and the patient responded quickly to doxycycline treatment. Physician awareness of HME and early diagnosis and treatment are essential to improve disease outcomes.

Dr. Peng is a postdoctoral research fellow at the Center for Diagnostics and Vaccine Development at the Taiwan Centers for Disease Control. His research interests include the epidemiology of rickettsial diseases and development of molecular detection methods for vectorborne infectious diseases.



This work was supported in part by grant nos. MOHW107-CDC-C-315-112303 and MOHW107-CDC-C-315-123110 from the Centers for Disease Control, Ministry of Health and Welfare, Taiwan, Republic of China.



  1. Dawson  JE, Anderson  BE, Fishbein  DB, Sanchez  JL, Goldsmith  CS, Wilson  KH, et al. Isolation and characterization of an Ehrlichia sp. from a patient diagnosed with human ehrlichiosis. J Clin Microbiol. 1991;29:27415.PubMedGoogle Scholar
  2. Heppner  DG, Wongsrichanalai  C, Walsh  DS, McDaniel  P, Eamsila  C, Hanson  B, et al. Human ehrlichiosis in Thailand. Lancet. 1997;350:7856. DOIPubMedGoogle Scholar
  3. Heo  EJ, Park  JH, Koo  JR, Park  MS, Park  MY, Dumler  JS, et al. Serologic and molecular detection of Ehrlichia chaffeensis and Anaplasma phagocytophila (human granulocytic ehrlichiosis agent) in Korean patients. J Clin Microbiol. 2002;40:30825. DOIPubMedGoogle Scholar
  4. Zhang  L, Shan  A, Mathew  B, Yin  J, Fu  X, Zhang  J, et al. Rickettsial Seroepidemiology among farm workers, Tianjin, People’s Republic of China. Emerg Infect Dis. 2008;14:93840. DOIPubMedGoogle Scholar
  5. Paddock  CD, Childs  JE. Ehrlichia chaffeensis: a prototypical emerging pathogen. Clin Microbiol Rev. 2003;16:3764. DOIPubMedGoogle Scholar
  6. Stone  JH, Dierberg  K, Aram  G, Dumler  JS. Human monocytic ehrlichiosis. JAMA. 2004;292:226370. DOIPubMedGoogle Scholar
  7. Biggs  HM, Behravesh  CB, Bradley  KK, Dahlgren  FS, Drexler  NA, Dumler  JS, et al. Diagnosis and management of tickborne rickettsial diseases: Rocky Mountain spotted fever and other spotted fever group rickettsioses, ehrlichioses, and anaplasmosis—United States. MMWR Recomm Rep. 2016;65:144. DOIPubMedGoogle Scholar
  8. Tsai  KH, Chang  SF, Yen  TY, Shih  WL, Chen  WJ, Wang  HC, et al. Prevalence of antibodies against Ehrlichia spp. and Orientia tsutsugamushi in small mammals around harbors in Taiwan. Parasit Vectors. 2016;9:45. DOIPubMedGoogle Scholar
  9. Kuo  CC, Lin  YF, Yao  CT, Shih  HC, Chung  LH, Liao  HC, et al. Tick-borne pathogens in ticks collected from birds in Taiwan. Parasit Vectors. 2017;10:587. DOIPubMedGoogle Scholar
  10. Nichols Heitman  K, Dahlgren  FS, Drexler  NA, Massung  RF, Behravesh  CB. Increasing incidence of ehrlichiosis in the United States: a summary of national surveillance of Ehrlichia chaffeensis and Ehrlichia ewingii infections in the United States, 2008–2012. Am J Trop Med Hyg. 2016;94:5260. DOIPubMedGoogle Scholar




Cite This Article

DOI: 10.3201/eid2511.190665

Original Publication Date: October 03, 2019

Table of Contents – Volume 25, Number 11—November 2019


Please use the form below to submit correspondence to the authors or contact them at the following address:

Pei-Yun Shu, Vector-Borne Viral and Rickettsial Diseases Laboratory, Center for Diagnostics and Vaccine Development, Centers for Disease Control, Ministry of Health and Welfare, No. 161, Kunyang St, Taipei 11561, Taiwan; email:

Send To

10000 character(s) remaining.


Page created: October 15, 2019
Page updated: October 15, 2019
Page reviewed: October 15, 2019
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.