Volume 27, Number 1—January 2021
Dispatch
Ocular Filariasis in Human Caused by Breinlia (Johnstonema) annulipapillata Nematode, Australia
Table
Designation | Primer pair | Oligonucleotide sequence, 5¢ → 3¢ | Annealing temperature, °C (time)† | Expected size, bp | Reference |
---|---|---|---|---|---|
SSU | |||||
1° PCR |
F18ScF1 | ACCGCCCTAGTTCTGACCGTAAA | 58 (45 s) |
830 |
(6) |
F18ScR1 |
GGTTCAAGCCACTGCGATTAAAGC |
||||
cox-1 | |||||
1° PCR | FCo1extdF1 | TATAATTCTGTTYTDACTA | 52 (45 s) | 970 | (6) |
FCo1extdR1 | ATGAAAATGAGCYACWACATAA | ||||
2° PCR | COIintF | TGATTGGTGGTTTTGGTAA | 52 (45 s) | 650 | (7) |
COIintR | ATAAGTACGAGTATCAATATC |
* cox-1, cytochrome c oxidase subunit 1; SSU small subunit of nuclear ribosomal RNA. †All PCRs used 35 cycles with an initial denaturation at 94°C for 5 min, all subsequent denaturation cycles were 30 s, and all extensions were 1 min.
References
- Otranto D, Eberhard ML. Zoonotic helminths affecting the human eye. Parasit Vectors. 2011;4:41. DOIPubMedGoogle Scholar
- Beaver PC. Intraocular filariasis: a brief review. Am J Trop Med Hyg. 1989;40:40–5. DOIPubMedGoogle Scholar
- Bain O, Otranto D, Diniz DG, dos Santos JN, de Oliveira NP, Frota de Almeida IN, et al. Human intraocular filariasis caused by Pelecitus sp. nematode, Brazil. Emerg Infect Dis. 2011;17:867–9. DOIPubMedGoogle Scholar
- Winkler S, Pollreisz A, Georgopoulos M, Bagò-Horvath Z, Auer H, To KK-W, et al. Candidatus Dirofilaria hongkongensis as causative agent of human ocular filariosis after travel to India. Emerg Infect Dis. 2017;23:1428–31. DOIPubMedGoogle Scholar
- Orr B, Ma G, Koh WL, Malik R, Norris JM, Westman ME, et al. Pig-hunting dogs are an at-risk population for canine heartworm (Dirofilaria immitis) infection in eastern Australia. Parasit Vectors. 2020;13:69. DOIPubMedGoogle Scholar
- Lefoulon E, Bain O, Bourret J, Junker K, Guerrero R, Cañizales I, et al. Shaking the tree: multi-locus sequence typing usurps current onchocercid (filarial nematode) phylogeny. PLoS Negl Trop Dis. 2015;9:
e0004233 . DOIPubMedGoogle Scholar - Casiraghi M, Anderson TJ, Bandi C, Bazzocchi C, Genchi C. A phylogenetic analysis of filarial nematodes: comparison with the phylogeny of Wolbachia endosymbionts. Parasitology. 2001;122:93–103. DOIPubMedGoogle Scholar
- Koehler AV, Haydon SR, Jex AR, Gasser RB. Cryptosporidium and Giardia taxa in faecal samples from animals in catchments supplying the city of Melbourne with drinking water (2011 to 2015). Parasit Vectors. 2016;9:315. DOIPubMedGoogle Scholar
- Kerkenezov N. Intra-ocular filariasis in Australia. Br J Ophthalmol. 1962;46:607–15. DOIPubMedGoogle Scholar
- Moorhouse DE. Dirofilaria immitis: a cause of human intra-ocular infection. Infection. 1978;6:192–3. DOIPubMedGoogle Scholar
- Boreham RE, Cooney PT, Stewart PA. Dirofilariasis with conjunctival inflammation. Med J Aust. 1997;167:51. DOIPubMedGoogle Scholar
- Chong EW, Sheorey H, Lo CH, Spratt DM, Graue-Hernández E. Subconjunctival dog heartworm. Med J Aust. 2010;193:184. DOIPubMedGoogle Scholar
- Huynh T, Thean J, Maini R. Dipetalonema reconditum in the human eye. Br J Ophthalmol. 2001;85:1391–2. DOIPubMedGoogle Scholar
- Spratt DM. New records of filarioid nematodes (Nematoda: Filarioidea) parasitic in Australasian monotremes, marsupials and murids, with descriptions of nine new species. Zootaxa. 2011;2860:1–61. DOIGoogle Scholar
Page created: September 17, 2020
Page updated: December 21, 2020
Page reviewed: December 21, 2020
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.