Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 27, Number 8—August 2021
Research

Spotted Fever Group Rickettsioses in Israel, 2010–2019

Regev CohenComments to Author , Talya Finn, Frida Babushkin, Yael Paran, Ronen Ben Ami, Alaa Atamna, Sharon Reisfeld, Gabriel Weber, Neta Petersiel, Hiba Zayyad, Eyal Leshem, Miriam Weinberger, Yasmin Maor, Nicola Makhoul, Lior Nesher, Galia Zaide, Dar Klein, Adi Beth-Din, and Yafit Atiya-Nasagi
Author affiliations: Laniado Hospital, Netanya, Israel (R. Cohen, T. Finn, F. Babushkin); Technion–Israel Institute of Technology, Haifa, Israel (R. Cohen, T. Finn, S. Reisfeld, G. Weber); Tel-Aviv Sourasky Medical Centre, Tel-Aviv, Israel (Y. Paran, R. Ben Ami); Tel Aviv University, Tel Aviv (Y. Paran, R. Ben Ami, A. Atamna, E. Leshem, M. Weinberger, Y. Maor); Rabin Medical Centre, Petah-Tikva, Israel (A. Atamna); Hillel Yaffe Medical Centre, Hadera, Israel (S. Reisfeld); Carmel Medical Centre, Haifa (G. Weber); Rambam Medical Centre, Haifa (N. Petersiel); Padeh Poriya Medical Centre, Tiberias, Israel (H. Zayyad); Bar Ilan University, Safed, Israel (H. Zayyad, N. Makhoul); S; heba Medical Centre, Ramat Gan, Israel (E. Leshem); Shamir (formerly Assaf Harofeh) Medical Center, Zerifin, Israel (M. Weinberger); Edith Wolfson Medical Centre, Holon, Israel (Y. Maor); Galilee Medical Centre, Nahariya, Israel (N. Makhoul); Soroka Medical Centre, Beer Sheba, Israel (L. Nesher); Ben-Gurion University of the Negev, Beer Sheba (L. Nesher); Israel Institute for Biological Research, Ness Ziona, Israel (G. Zaide, D. Klein, A. Beth-Din, Y. Atiya-Nasagi)

Main Article

Table 1

Oligonucleotide primers used for PCR amplification and sequencing of Rickettsia species in study of spotted fever group rickettsioses in Israel, 2010–2019*

Primer Target gene Primer sequence, 5′ → 3′
213F OmpA AATCAATATTGGAGCCGGTAA
667R OmpA ATTTGCATCAATCGTATAAGTAGC
120F OmpA AAGGAGCTATAGCAAACGGCA
760R OmpA TATCAGGGTCTATATTCGCACCTA
760newF OmpA TAGGTGCGAATATAGACCCTGATA
1231R OmpA TGGCAATAGTTACATTTCCTGCAC
373F gltA TTGTAGCTCTTCTCATCCTATGGC
1138R gltA CATTTGCGACGGTATACCCATA
Rico173F gltA CGACCCGGGTTTTATGTCTA
1179R gltA TCCAGCCTACGATTCTTGCTA
gltA_EXT_R gltA TACTCTCTATGTACATAACCGGTG
gltA_NES_F gltA ATGATTGCTAAGATACCTACCATC
1497_R OmpB CCTATATCGCCGGTAATT
3462_F OmpB CCACAGGAACTACAACCATT
4346_R OmpB CGAAGAAGTAACGCTGACTT
607_F OmpB AATATCGGTGACGGTCAAGG
D1390R Sca4 CTTGCTTTTCAGCAATATCAC
D767F Sca4 CGATGGTAGCATTAAAAGCT

*All primers were designed at the Israel Institute for Biological Research (Ness Ziona, Israel), except Rico173F (25), rickettsial OmpB primers (28), and sca4 primers (29).

Main Article

References
  1. Diop  A, Raoult  D, Fournier  PE. Rickettsial genomics and the paradigm of genome reduction associated with increased virulence. Microbes Infect. 2018;20:401–9. DOIPubMedGoogle Scholar
  2. Blanton  LS, Walker  DH. Rickettsia rickettsii and other spotted fever group rickettsiae (Rocky Mountain spotted fever and other spotted fevers). In: Bennett JE, Dolin R, Blaser MJ, editors. Mandell, Douglas, and Bennett’s principles and practice of infectious diseases, 9th ed. Amsterdam: Elsevier; 2020.
  3. Parola  P, Paddock  CD, Socolovschi  C, Labruna  MB, Mediannikov  O, Kernif  T, et al. Update on tick-borne rickettsioses around the world: a geographic approach. Clin Microbiol Rev. 2013;26:657–702. DOIPubMedGoogle Scholar
  4. Bacellar  F, Beati  L, França  A, Poças  J, Regnery  R, Filipe  A. Israeli spotted fever rickettsia (Rickettsia conorii complex) associated with human disease in Portugal. Emerg Infect Dis. 1999;5:835–6. DOIPubMedGoogle Scholar
  5. Colomba  C, Trizzino  M, Giammanco  A, Bonura  C, Di Bona  D, Tolomeo  M, et al. Israeli Spotted Fever in Sicily. Description of two cases and minireview. Int J Infect Dis. 2017;61:7–12. DOIPubMedGoogle Scholar
  6. Zhu  Y, Fournier  PE, Eremeeva  M, Raoult  D. Proposal to create subspecies of Rickettsia conorii based on multi-locus sequence typing and an emended description of Rickettsia conorii. BMC Microbiol. 2005;5:11. DOIPubMedGoogle Scholar
  7. Znazen  A, Hammami  B, Lahiani  D, Ben Jemaa  M, Hammami  A. Israeli spotted fever, Tunisia. Emerg Infect Dis. 2011;17:1328–30. DOIPubMedGoogle Scholar
  8. Angelakis  E, Richet  H, Raoult  D. Rickettsia sibirica mongolitimonae Infection, France, 2010-2014. Emerg Infect Dis. 2016;22:880–2. DOIPubMedGoogle Scholar
  9. Cohen  R, Babushkin  F, Shapiro  M, Uda  M, Atiya-Nasagi  Y, Klein  D, et al. Two cases of Israeli spotted fever with purpura fulminans, Sharon District, Israel. Emerg Infect Dis. 2018;24:835–40. DOIPubMedGoogle Scholar
  10. de Sousa  R, Nóbrega  SD, Bacellar  F, Torgal  J. Mediterranean spotted fever in Portugal: risk factors for fatal outcome in 105 hospitalized patients. Ann N Y Acad Sci. 2003;990:285–94. DOIPubMedGoogle Scholar
  11. Parola  P, Rovery  C, Rolain  JM, Brouqui  P, Davoust  B, Raoult  D. Rickettsia slovaca and R. raoultii in tick-borne Rickettsioses. Emerg Infect Dis. 2009;15:1105–8. DOIPubMedGoogle Scholar
  12. Sousa  R, França  A, Dória Nòbrega  S, Belo  A, Amaro  M, Abreu  T, et al. Host- and microbe-related risk factors for and pathophysiology of fatal Rickettsia conorii infection in Portuguese patients. J Infect Dis. 2008;198:576–85. DOIPubMedGoogle Scholar
  13. Raoult  D, Weiller  PJ, Chagnon  A, Chaudet  H, Gallais  H, Casanova  P. Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg. 1986;35:845–50. DOIPubMedGoogle Scholar
  14. Aharonowitz  G, Koton  S, Segal  S, Anis  E, Green  MS. Epidemiological characteristics of spotted fever in Israel over 26 years. Clin Infect Dis. 1999;29:1321–2. DOIPubMedGoogle Scholar
  15. Weinberger  M, Keysary  A, Sandbank  J, Zaidenstein  R, Itzhaki  A, Strenger  C, et al. Fatal Rickettsia conorii subsp. israelensis infection, Israel. Emerg Infect Dis. 2008;14:821–4. DOIPubMedGoogle Scholar
  16. Paddock  CD, Childs  JE, Zaki  SR, Berger  SA. Reply. J Infect Dis. 2000;181:810–2. DOIPubMedGoogle Scholar
  17. Leitner  M, Yitzhaki  S, Rzotkiewicz  S, Keysary  A. Polymerase chain reaction-based diagnosis of Mediterranean spotted fever in serum and tissue samples. Am J Trop Med Hyg. 2002;67:166–9. DOIPubMedGoogle Scholar
  18. Regev-Yochay  G, Segal  E, Rubinstein  E. Glucose-6-phosphate dehydrogenase deficiency: possible determinant for a fulminant course of Israeli spotted fever. Isr Med Assoc J. 2000;2:781–2.PubMedGoogle Scholar
  19. Ergas  D, Sthoeger  ZM, Keysary  A, Strenger  C, Leitner  M, Zimhony  O. Early diagnosis of severe Mediterranean spotted fever cases by nested-PCR detecting spotted fever Rickettsiae 17-kD common antigen gene. Scand J Infect Dis. 2008;40:965–7. DOIPubMedGoogle Scholar
  20. Cohen  J, Lasri  Y, Landau  Z; Joel Cohen, Yechiel Lasri, Zvi Land. Mediterranean spotted fever in pregnancy. Scand J Infect Dis. 1999;31:202–3. DOIPubMedGoogle Scholar
  21. Bentov  Y, Sheiner  E, Kenigsberg  S, Mazor  M. Mediterranean spotted fever during pregnancy: case presentation and literature review. Eur J Obstet Gynecol Reprod Biol. 2003;107:214–6. DOIPubMedGoogle Scholar
  22. Shazberg  G, Moise  J, Terespolsky  N, Hurvitz  H. Family outbreak of Rickettsia conorii infection. Emerg Infect Dis. 1999;5:723–4. DOIPubMedGoogle Scholar
  23. Cwikel  BJ, Ighbarieh  J, Sarov  I. Antigenic polypeptides of Israeli spotted fever isolates compared with other spotted fever group rickettsiae. Ann N Y Acad Sci. 1990;590(1 Rickettsiolog):381–8.
  24. Israel Center for Disease Control Ministry of Health. Publication files, infectious diseases, notifiable infectious diseases in Israel [in Hebrew] [cited 2020 Apr 15]. https://www.health.gov.il/UnitsOffice/HD/PH/epidemiology/Pages/epidemiology_report.aspx
  25. Harrus  S, Perlman-Avrahami  A, Mumcuoglu  KY, Morick  D, Baneth  G. Molecular detection of Rickettsia massiliae, Rickettsia sibirica mongolitimonae and Rickettsia conorii israelensis in ticks from Israel. Clin Microbiol Infect. 2011;17:176–80. DOIPubMedGoogle Scholar
  26. Keysary  A, Strenger  C. Use of enzyme-linked immunosorbent assay techniques with cross-reacting human sera in diagnosis of murine typhus and spotted fever. J Clin Microbiol. 1997;35:1034–5. DOIPubMedGoogle Scholar
  27. Klein  D, Beth-Din  A, Cohen  R, Lazar  S, Glinert  I, Zayyad  H, et al. New spotted fever group Rickettsia isolate, identified by sequence analysis of conserved genomic regions. Pathogens. 2019;9:E11. DOIPubMedGoogle Scholar
  28. Roux  V, Raoult  D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000;50:1449–55. DOIPubMedGoogle Scholar
  29. Sekeyova  Z, Roux  V, Raoult  D. Phylogeny of Rickettsia spp. inferred by comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Int J Syst Evol Microbiol. 2001;51:1353–60. DOIPubMedGoogle Scholar
  30. Bechah  Y, Socolovschi  C, Raoult  D. Identification of rickettsial infections by using cutaneous swab specimens and PCR. Emerg Infect Dis. 2011;17:83–6. DOIPubMedGoogle Scholar
  31. Rose  J, Nachum-Biala  Y, Mumcuoglu  KY, Alkhamis  MA, Ben-Nun  A, Lensky  I, et al. Genetic characterization of spotted fever group rickettsiae in questing ixodid ticks collected in Israel and environmental risk factors for their infection. Parasitology. 2017;144:1088–101. DOIPubMedGoogle Scholar
  32. Sentausa  E, El Karkouri  K, Robert  C, Raoult  D, Fournier  PE. Genome sequence of Rickettsia conorii subsp. israelensis, the agent of Israeli spotted fever. J Bacteriol. 2012;194:5130–1. DOIPubMedGoogle Scholar
  33. Heitman  KN, Drexler  NA, Cherry-Brown  D, Peterson  AE, Armstrong  PA, Kersh  GJ. National surveillance data show increase in spotted fever rickettsiosis: United States, 2016-2017. Am J Public Health. 2019;109:719–21. DOIPubMedGoogle Scholar
  34. Mumcuoglu  KY, Keysary  A, Gilead  L. Mediterranean spotted fever in Israel: a tick-borne disease. Isr Med Assoc J. 2002;4:44–9.PubMedGoogle Scholar
  35. Ereqat  S, Nasereddin  A, Al-Jawabreh  A, Azmi  K, Harrus  S, Mumcuoglu  K, et al. Molecular detection and identification of spotted fever group rickettsiae in ticks collected from the West Bank, Palestinian Territories. PLoS Negl Trop Dis. 2016;10:e0004348. DOIPubMedGoogle Scholar
  36. Kamani  J, Baneth  G, Mumcuoglu  KY, Waziri  NE, Eyal  O, Guthmann  Y, et al. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria. PLoS Negl Trop Dis. 2013;7:e2108. DOIPubMedGoogle Scholar
  37. Chisu  V, Masala  G, Foxi  C, Socolovschi  C, Raoult  D, Parola  P. Rickettsia conorii israelensis in Rhipicephalus sanguineus ticks, Sardinia, Italy. Ticks Tick Borne Dis. 2014;5:446–8. DOIPubMedGoogle Scholar
  38. Waner  T, Keysary  A, Eremeeva  ME, Din  AB, Mumcuoglu  KY, King  R, et al. Rickettsia africae and Candidatus Rickettsia barbariae in ticks in Israel. Am J Trop Med Hyg. 2014;90:920–2. DOIPubMedGoogle Scholar
  39. Eldin  C, Virgili  G, Attard  L, Edouard  S, Viale  P, Raoult  D, et al. Rickettsia massiliae infection after a tick bite on the eyelid. Travel Med Infect Dis. 2018;26:66–8. DOIPubMedGoogle Scholar
  40. Socolovschi  C, Gaudart  J, Bitam  I, Huynh  TP, Raoult  D, Parola  P. Why are there so few Rickettsia conorii conorii-infected Rhipicephalus sanguineus ticks in the wild? PLoS Negl Trop Dis. 2012;6:e1697. DOIPubMedGoogle Scholar
  41. Parola  P, Socolovschi  C, Raoult  D. Deciphering the relationships between Rickettsia conorii conorii and Rhipicephalus sanguineus in the ecology and epidemiology of Mediterranean spotted fever. Ann N Y Acad Sci. 2009;1166:49–54. DOIPubMedGoogle Scholar
  42. Socolovschi  C, Raoult  D, Parola  P. Influence of temperature on the attachment of Rhipicephalus sanguineus ticks on rabbits. Clin Microbiol Infect. 2009;15(Suppl 2):326–7. DOIPubMedGoogle Scholar

Main Article

Page created: June 09, 2021
Page updated: July 18, 2021
Page reviewed: July 18, 2021
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external