Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 7, Number 1—February 2001
Synopsis

Geographic Subdivision of the Range of the Malaria Parasite, Plasmodium vivax

Jun Li*, William E. Collins†, Robert A. Wirtz†, Dharmendar Rathore*, Altaf Lal†, and Thomas F. McCutchan*Comments to Author 
Author affiliations: *National Institutes of Health, Bethesda, Maryland, USA; †Centers for Disease Control and Prevention, Atlanta, Georgia, USA

Main Article

Figure 4

Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273 (5'GCACAATTTGAACGTAC3') (11).

Figure 4. Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273 (5'GCACAATTTGAACGTAC3') (11).

Main Article

References
  1. Bruce-Chwatt  LJ. Essential malariology. New York: John Wiley and Sons; 1985.
  2. Mayr  E. Animal species and evolution. Cambridge: Belknap Press of Harvard University Press; 1963.
  3. Killick-Kendrick  R. In: Peters W, editor. Rodent malaria. London: Academic Press; 1978.
  4. Collins  WE, Skinner  JC, Pappaioanou  M, Ma  NS, Broderson  JR, Sutton  BB, Infection of Aotus vociferans (karyotype V) monkeys with different strains of Plasmodium vivax. J Parasitol. 1987;73:53640. DOIPubMed
  5. Collins  WE, Warren  M, Huong  AY, Skinner  JC, Sutton  BB, Stanfill  PS. Studies of comparative infectivity of fifteen strains of Plasmodium vivax to laboratory-reared anopheline mosquitoes, with special reference to Anopheles culicifacies. J Parasitol. 1986;72:5214. DOIPubMed
  6. Collins  WE, McClure  H, Strobert  E, Skinner  JC, Richardson  BB, Roberts, et al. Experimental infection of Anopheles gambiae s.s., Anopheles freeborni, and Anopheles stephensi with Plasmodium malariae and Plasmodium brasilianum. J Am Mosq Control Assoc. 1993;9:6871.PubMed
  7. Li  J, Wirtz  RA, McCutchan  TF. Analysis of malaria parasite RNA from decade-old giemsa-stained blood smears and dried mosquitoes. Am J Trop Med Hyg. 1997;57:72731.PubMed
  8. Li  J, Wirtz  RA, McConkey  GA, Sattabongkot  J, McCutchan  TF. Transition of Plasmodium vivax ribosome types corresponds to sporozoite differentiation in the mosquito. Mol Biochem Parasitol. 1994;65:2839. DOIPubMed
  9. Wirtz  RA, Burkot  TR, Andre  RG, Rosenberg  R, Collins  WE, Roberts  DR. Identification of Plasmodium vivax sporozoites in mosquitoes using an enzyme-linked immunosorbent assay. Am J Trop Med Hyg. 1985;34:104854.PubMed
  10. Li  J, Wirtz  RA, McConkey  GA, Sattabongkot  J, Waters  AP, Rogers  MJ, Plasmodium: genus-conserved primers for species identification and quantitation. Exp Parasitol. 1995;81:18290. DOIPubMed
  11. Wilson  RJM, Denny  PW, Preiser  PR, Rangachari  K, Roberts  K, Roy  A, Complete gene map of the plastid-like DNA of the malaria parasite Plasmodium falciparum. J Mol Biol. 1996;261:15572. DOIPubMed
  12. Waters  AP, McCutchan  TF. Partial sequence of the asexually expressed SU rRNA gene of Plasmodium vivax [published erratum appears in Nucleic Acids Res 1989 May 11;17:3630-1]. Nucleic Acids Res. 1989;17:2135. DOIPubMed
  13. Escalante  A, Barrio  E, Ayala  FJ. Evolutionary origin of human and primate malarias: evidence from the circumsporozoite protein gene. Mol Biol Evol. 1995;12:61626.PubMed
  14. Vaidya  AB, Morrisey  J, Plowe  CV, Kaslow  DC, Wellems  TE. Unidirectional dominance of cytoplasmic inheritance in two genetic crosses of Plasmodium falciparum. Mol Cell Biol. 1993;13:734957.PubMed
  15. Gupta  S, Ferguson  N, Anderson  R. Chaos, persistence and evolution of strain structure in antigenically diverse infectious agents. Science. 1998;280:9125. DOIPubMed
  16. Lal  AA, de la Cruz  VF, Collins  WE, Campbell  GH, Procell  PM, McCutchan  TF. Circumsporozoite protein gene from Plasmodium brasilianum. Animal reservoirs for human malaria parasites? J Biol Chem. 1988;263:54958.PubMed
  17. Escalante  AA, Freeland  DE, Collins  WE, Lal  AA. The evolution of primate malaria parasites based on the gene encoding cytochrome-b from the linear mitochondrial genome. Proc Natl Acad Sci U S A. 1998;95:81249. DOIPubMed
  18. Kain  KC, Brown  AE, Webster  HK, Wirtz  A, Keystone  JS, Rodriguez  MH, Circumsporozoite genotyping of global isolates of Plasmodium vivax from dried blood specimens. J Clin Microbiol. 1992;30:18636.PubMed
  19. Simpson  GC. Tempo and mode in evolution. New York: Columbia University Press; 1944.
  20. Coatney  GR, Collins  WE, Warren  M, Contacos  PG. The primate malarias. Bethesda: Dept of Health, Education and Welfare (US); 1971.
  21. Gonzalez-Ceron  L, Rodriquez  MH, Nettel  JC, Villarreal  C, Kain  KC, Hernandez  JE. Differential susceptibilities of Anopheles albimanus and An. pseudopunctipennis to infections with coindigenous Plasmodium vivax variants VK210 and VK247 in southern Mexico. Infect Immun. 1999;67:4102.PubMed

Main Article

¹The biologic diversity inherent in P. vivax already justifies the use of a trinomial system for naming its members that includes the designation of subspecies, a taxonomic character given formal recognition in the International Rules of Zoological Nomenclature. A subspecies is a population or group of populations inhabiting a geographic subdivision of the range of a species and differing from other populations by diagnostic morphologic characteristics.

²The designation of separate species does not require that the two organisms cannot mate and produce viable progeny, only that this does not happen with frequency in natural situations.

Page created: March 16, 2011
Page updated: March 16, 2011
Page reviewed: March 16, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external