Volume 10, Number 10—October 2004
Research
Escherichia coli and Community-acquired Gastroenteritis, Melbourne, Australia
Table 1
Target gene or virulence factor | Primera | Primer sequence (5′ to 3′) | PCR program (30 cycles)b | Product size (bp) | Reference |
---|---|---|---|---|---|
eae | 11 21 | GACCCGGCACAAGCATAAGC CCACCTGCAGCAACAAGAGG | 95°C, 30 s; 54°C, 90 s; 72°C, 90 s | 384 | (8) |
ehxA | 11 21 | GCATCATCAAGCGTACGTTCC AATGAGCCAAGCTGGTTAAGCT | 534 | (8) | |
stx1 | 12 22 | ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC | 95°C, 30 s; 52°C, 60 s; 72°C, 60 sc | 180 | (8) |
stx2 | 12 22 | GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG | 255 | (8) | |
ltA | 13 23 | GGCGACAGATTATACCGTGC CCGAATTCTGTTATATATGTC | 94°C, 60 s; 50°C, 60 s; 72°C, 120 sc | 696 | (9) |
st1A | 13 23 | TCTGTATTATCTTTCCCCTC ATAACATCCAGCACAGGC | 186 | (9) | |
ipaC | 1 2 | CAGCAGATTGCAGCGCATAT CAAGAGCAGATGCATAACGC | 94°C, 30 s; 59°C, 90 s; 72°C, 90 s | 811 | This study |
bfpA | 1 2 | ATTGAATCTGCAATGGTGC ATAGCAGTCGATTTAGCAGCC | 95°C, 40 s; 55°C, 40 s; 72°C, 40 s | 461 | This study |
pCVD432 | 1 2 | CTGGCGAAAGACTGTATCAT CAATGTATAGAAATCCGCTGTT | 94°C, 40 s; 53°C, 60 s; 72°C, 60 s | 630 | (10) |
aggA | 1 2 | ATGCATTACTTTGGGTTTAG TCAACCTTGACACTTGCC | 94°C, 60 s; 50°C, 60 s; 72°C, 120 sc | 414 | This study |
lacZ | 1 2 | TGATTGAAGCAGAAGCCTGC CGCCAATCCACATCTGTGAA | 94°C, 30 s; 59°C, 90 s; 72°C, 90 s | 1,350 | This study |
aPrimers with the same superscript were used in duplex PCRs.
bBefore the first cycle, the sample was denatured for 10 min at 95°C; after the last cycle, the sample was extended for 8 min at 72°C.
c35 cycles.
References
- Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142–201.PubMedGoogle Scholar
- Robins-Browne RM. Traditional enteropathogenic Escherichia coli of infantile diarrhea. Rev Infect Dis. 1987;9:28–53. DOIPubMedGoogle Scholar
- Trabulsi LR, Keller R, Gomes TAT. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis. 2002;8:508–13.PubMedGoogle Scholar
- Bieber D, Ramer SW, Wu CY, Murray WJ, Tobe T, Fernandez R, Type IV pili, transient bacterial aggregates, and virulence of enteropathogenic Escherichia coli. Science. 1998;280:2114–8. DOIPubMedGoogle Scholar
- Nougayrède JP, Fernandes PJ, Donnenberg MS. Adhesion of enteropathogenic Escherichia coli to host cells. Cell Microbiol. 2003;5:359–72. DOIPubMedGoogle Scholar
- Hellard ME, Sinclair MI, Forbes AB, Fairley CK. A randomized, blinded, controlled trial investigating the gastrointestinal health effects of drinking water quality. Environ Health Perspect. 2001;109:773–8. DOIPubMedGoogle Scholar
- Hellard ME, Sinclair MI, Hogg GG, Fairley CK. Prevalence of enteric pathogens among community based asymptomatic individuals. J Gastroenterol Hepatol. 2000;15:290–3. DOIPubMedGoogle Scholar
- Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol. 1998;36:598–602.PubMedGoogle Scholar
- Schultsz C, Pool GJ, van Ketel R, de Wever B, Speelman P, Dankert J. Detection of enterotoxigenic Escherichia coli in stool samples by using nonradioactively labeled oligonucleotide DNA probes and PCR. J Clin Microbiol. 1994;32:2393–7.PubMedGoogle Scholar
- Schmidt H, Knop C, Franke S, Aleksic S, Heesemann J, Karch H. Development of PCR for screening of enteroaggregative Escherichia coli. J Clin Microbiol. 1995;33:701–5.PubMedGoogle Scholar
- Vial PA, Mathewson JJ, Guers L, Levine MM, DuPont HL. Comparison of two assay methods for patterns of adherence to HEp-2 cells of Escherichia coli from patients with diarrhea. J Clin Microbiol. 1990;28:882–5.PubMedGoogle Scholar
- Levine MM, Nataro JP, Karch H, Baldini MM, Kaper JB, Black RE, The diarrheal response of humans to some classic serotypes of enteropathogenic Escherichia coli is dependent on a plasmid encoding an enteroadhesiveness factor. J Infect Dis. 1985;152:550–9. DOIPubMedGoogle Scholar
- Wood PK, Morris JG Jr, Small PLC, Sethabutr O, Toledo MRF, Trabulsi L, Comparison of DNA probes and the Sereny test for identification of invasive Shigella and Escherichia coli strains. J Clin Microbiol. 1986;24:498–500.PubMedGoogle Scholar
- Satterwhite TK, Evans DG, DuPont HL, Evans DJ Jr. Role of Escherichia coli colonisation factor antigen in acute diarrhoea. Lancet. 1978;2:181–4. DOIPubMedGoogle Scholar
- Perna NT, Plunkett G, Burland V, Mau B, Glasner JD, Rose DJ, Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature. 2001;409:529–33. DOIPubMedGoogle Scholar
- Bettelheim KA, Thompson CJ. New method of serotyping Escherichia coli: implementation and verification. J Clin Microbiol. 1987;25:781–6.PubMedGoogle Scholar
- Reid SD, Betting DJ, Whittam TS. Molecular detection and identification of intimin alleles in pathogenic Escherichia coli by multiplex PCR. J Clin Microbiol. 1999;37:2719–22.PubMedGoogle Scholar
- Zhang WL, Kohler B, Oswald E, Beutin L, Karch H, Morabito S, Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. J Clin Microbiol. 2002;40:4486–92. DOIPubMedGoogle Scholar
- Newton HJ, Sloan J, Bennett-Wood V, Adams LM, Robins-Browne RM, Hartland EL. Contribution of long polar fimbriae to the virulence of rabbit-specific enteropathogenic Escherichia coli. Infect Immun. 2004;72:1230–7. DOIPubMedGoogle Scholar
- Klapproth JM, Scaletsky IC, McNamara BP, Lai LC, Malstrom C, James SP, A large toxin from pathogenic Escherichia coli strains that inhibits lymphocyte activation. Infect Immun. 2000;68:2148–55. DOIPubMedGoogle Scholar
- Yatsuyanagi J, Saito S, Sato H, Miyajima Y, Amano K, Enomoto K. Characterization of enteropathogenic and enteroaggregative Escherichia coli isolated from diarrheal outbreaks. J Clin Microbiol. 2002;40:294–7. DOIPubMedGoogle Scholar
- Knutton S, Phillips AD, Smith HR, Gross RJ, Shaw R, Watson P, Screening for enteropathogenic Escherichia coli in infants with diarrhea by the fluorescent-actin staining test. Infect Immun. 1991;59:365–71.PubMedGoogle Scholar
- McDaniel TK, Jarvis KG, Donnenberg MS, Kaper JB. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci U S A. 1995;92:1664–8. DOIPubMedGoogle Scholar
- Robins-Browne RM, Bennett-Wood V. Quantitative assessment of the ability of Escherichia coli to invade cultured animal cells. Microb Pathog. 1992;12:159–64. DOIPubMedGoogle Scholar
- Nicholls L, Grant TH, Robins-Browne RM. Identification of a novel locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol Microbiol. 2000;35:275–88. DOIPubMedGoogle Scholar
- Yatsuyanagi J, Saito S, Miyajima Y, Amano K, Enomoto K. Characterization of atypical enteropathogenic Escherichia coli strains harboring the astA gene that were associated with a waterborne outbreak of diarrhea in Japan. J Clin Microbiol. 2003;41:2033–9. DOIPubMedGoogle Scholar
- Scaletsky IC, Pedroso MZ, Oliva CA, Carvalho RL, Morais MB, Fagundes-Neto U. A localized adherence-like pattern as a second pattern of adherence of classic enteropathogenic Escherichia coli to HEp-2 cells that is associated with infantile diarrhea. Infect Immun. 1999;67:3410–5.PubMedGoogle Scholar
- Pelayo JS, Scaletsky IC, Pedroso MZ, Sperandio V, Girón JA, Frankel G, Virulence properties of atypical EPEC strains. J Med Microbiol. 1999;48:41–9. DOIPubMedGoogle Scholar
- Feng P, Lampel KA, Karch H, Whittam TS. Genotypic and phenotypic changes in the emergence of Escherichia coli O157:H7. J Infect Dis. 1998;177:1750–3. DOIPubMedGoogle Scholar
- Marshall JA, Hellard ME, Sinclair MI, Fairley CK, Cox BJ, Catton MG, Incidence and characteristics of endemic Norwalk-like virus-associated gastroenteritis. J Med Virol. 2003;69:568–78. DOIPubMedGoogle Scholar
- Viljanen MK, Peltola T, Junnila SY, Olkkonen L, Jarvinen H, Kuistila M, Outbreak of diarrhoea due to Escherichia coli O111:B4 in schoolchildren and adults: association of Vi antigen-like reactivity. Lancet. 1990;336:831–4. DOIPubMedGoogle Scholar
- Bouzari S, Jafari MN, Shokouhi F, Parsi M, Jafari A. Virulence-related DNA sequences and adherence patterns in strains of enteropathogenic Escherichia coli. FEMS Microbiol Lett. 2000;185:89–93. DOIPubMedGoogle Scholar
- Galane PM, Le Roux M. Molecular epidemiology of Escherichia coli isolated from young South African children with diarrhoeal diseases. J Health Popul Nutr. 2001;19:31–8.PubMedGoogle Scholar
- Knutton S, Shaw R, Phillips AD, Smith HR, Willshaw GA, Watson P, Phenotypic and genetic analysis of diarrhea-associated Escherichia coli isolated from children in the United Kingdom. J Pediatr Gastroenterol Nutr. 2001;33:32–40. DOIPubMedGoogle Scholar
- Paciorek J. Virulence properties of Escherichia coli faecal strains isolated in Poland from healthy children and strains belonging to serogroups O18, O26, O44, O86, O126 and O127 isolated from children with diarrhoea. J Med Microbiol. 2002;51:548–56.PubMedGoogle Scholar
- Kukuruzovic R, Robins-Browne RM, Anstey NM, Brewster DR. Enteric pathogens, intestinal permeability and nitric oxide production in acute gastroenteritis. Pediatr Infect Dis J. 2002;21:730–9. DOIPubMedGoogle Scholar
- Robins-Browne RM, Yam WC, O’Gorman LE, Bettelheim KA. Examination of archetypal strains of enteropathogenic Escherichia coli for properties associated with bacterial virulence. J Med Microbiol. 1993;38:222–6. DOIPubMedGoogle Scholar
- Yamamoto T, Taneike I. The sequences of enterohemorrhagic Escherichia coli and Yersinia pestis that are homologous to the enteroaggregative E. coli heat-stable enterotoxin gene: cross-species transfer in evolution. FEBS Lett. 2000;472:22–6. DOIPubMedGoogle Scholar
- Beutin L, Marches O, Bettelheim KA, Gleier K, Zimmermann S, Schmidt H, HEp-2 cell adherence, actin aggregation, and intimin types of attaching and effacing Escherichia coli strains isolated from healthy infants in Germany and Australia. Infect Immun. 2003;71:3995–4002. DOIPubMedGoogle Scholar
- Vieira MA, Andrade JR, Trabulsi LR, Rosa AC, Dias AM, Ramos SR, Phenotypic and genotypic characteristics of Escherichia coli strains of non-enteropathogenic E. coli (EPEC) serogroups that carry EAE and lack the EPEC adherence factor and Shiga toxin DNA probe sequences. J Infect Dis. 2001;183:762–72. DOIPubMedGoogle Scholar
- Francis CL, Jerse AE, Kaper JB, Falkow S. Characterization on interactions of enteropathogenic Escherichia coli O127:H6 with mammalian cells in vitro. J Infect Dis. 1991;164:693–703. DOIPubMedGoogle Scholar
1Current affiliation: Burnet Institute, Melbourne, Victoria, Australia.
Page created: April 11, 2011
Page updated: April 11, 2011
Page reviewed: April 11, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.