Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 10, Number 10—October 2004
Research

Escherichia coli and Community-acquired Gastroenteritis, Melbourne, Australia

Roy M. Robins-Browne*†Comments to Author , Anne-Marie Bordun*†, Marija Tauschek*, Vicki R. Bennett-Wood*†, Jacinta Russell†, Frances Oppedisano†, Nicole A. Lister*, Karl A. Bettelheim*, Christopher K. Fairley*, Martha I. Sinclair‡, and Margaret E. Hellard‡1
Author affiliations: *University of Melbourne, Melbourne, Victoria, Australia; †Murdoch Childrens Research Institute, Melbourne, Victoria, Australia; ‡Monash University, Melbourne, Victoria, Australia

Main Article

Table 1

Characteristics of the polymerase chain reaction (PCR) primers used to detect pathogenic Escherichia coli in mixed culture

Target gene or virulence factor Primera Primer sequence (5′ to 3′) PCR program (30 cycles)b Product size (bp) Reference
eae 11
21 GACCCGGCACAAGCATAAGC
CCACCTGCAGCAACAAGAGG 95°C, 30 s; 54°C, 90 s; 72°C, 90 s 384 (8)
ehxA 11
21 GCATCATCAAGCGTACGTTCC
AATGAGCCAAGCTGGTTAAGCT 534 (8)
stx1 12
22 ATAAATCGCCATTCGTTGACTAC
AGAACGCCCACTGAGATCATC 95°C, 30 s; 52°C, 60 s; 72°C, 60 sc 180 (8)
stx2 12
22 GGCACTGTCTGAAACTGCTCC
TCGCCAGTTATCTGACATTCTG 255 (8)
ltA 13
23 GGCGACAGATTATACCGTGC
CCGAATTCTGTTATATATGTC 94°C, 60 s; 50°C, 60 s; 72°C, 120 sc 696 (9)
st1A 13
23 TCTGTATTATCTTTCCCCTC
ATAACATCCAGCACAGGC 186 (9)
ipaC 1
2 CAGCAGATTGCAGCGCATAT
CAAGAGCAGATGCATAACGC 94°C, 30 s; 59°C, 90 s; 72°C, 90 s 811 This study
bfpA 1
2 ATTGAATCTGCAATGGTGC
ATAGCAGTCGATTTAGCAGCC 95°C, 40 s; 55°C, 40 s; 72°C, 40 s 461 This study
pCVD432 1
2 CTGGCGAAAGACTGTATCAT
CAATGTATAGAAATCCGCTGTT 94°C, 40 s; 53°C, 60 s; 72°C, 60 s 630 (10)
aggA 1
2 ATGCATTACTTTGGGTTTAG
TCAACCTTGACACTTGCC 94°C, 60 s; 50°C, 60 s; 72°C, 120 sc 414 This study
lacZ 1
2 TGATTGAAGCAGAAGCCTGC
CGCCAATCCACATCTGTGAA 94°C, 30 s; 59°C, 90 s; 72°C, 90 s 1,350 This study

aPrimers with the same superscript were used in duplex PCRs.
bBefore the first cycle, the sample was denatured for 10 min at 95°C; after the last cycle, the sample was extended for 8 min at 72°C.
c35 cycles.

Main Article

References
  1. Nataro  JP, Kaper  JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142201.PubMedGoogle Scholar
  2. Robins-Browne  RM. Traditional enteropathogenic Escherichia coli of infantile diarrhea. Rev Infect Dis. 1987;9:2853. DOIPubMedGoogle Scholar
  3. Trabulsi  LR, Keller  R, Gomes  TAT. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis. 2002;8:50813.PubMedGoogle Scholar
  4. Bieber  D, Ramer  SW, Wu  CY, Murray  WJ, Tobe  T, Fernandez  R, Type IV pili, transient bacterial aggregates, and virulence of enteropathogenic Escherichia coli. Science. 1998;280:21148. DOIPubMedGoogle Scholar
  5. Nougayrède  JP, Fernandes  PJ, Donnenberg  MS. Adhesion of enteropathogenic Escherichia coli to host cells. Cell Microbiol. 2003;5:35972. DOIPubMedGoogle Scholar
  6. Hellard  ME, Sinclair  MI, Forbes  AB, Fairley  CK. A randomized, blinded, controlled trial investigating the gastrointestinal health effects of drinking water quality. Environ Health Perspect. 2001;109:7738. DOIPubMedGoogle Scholar
  7. Hellard  ME, Sinclair  MI, Hogg  GG, Fairley  CK. Prevalence of enteric pathogens among community based asymptomatic individuals. J Gastroenterol Hepatol. 2000;15:2903. DOIPubMedGoogle Scholar
  8. Paton  AW, Paton  JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol. 1998;36:598602.PubMedGoogle Scholar
  9. Schultsz  C, Pool  GJ, van Ketel  R, de Wever  B, Speelman  P, Dankert  J. Detection of enterotoxigenic Escherichia coli in stool samples by using nonradioactively labeled oligonucleotide DNA probes and PCR. J Clin Microbiol. 1994;32:23937.PubMedGoogle Scholar
  10. Schmidt  H, Knop  C, Franke  S, Aleksic  S, Heesemann  J, Karch  H. Development of PCR for screening of enteroaggregative Escherichia coli. J Clin Microbiol. 1995;33:7015.PubMedGoogle Scholar
  11. Vial  PA, Mathewson  JJ, Guers  L, Levine  MM, DuPont  HL. Comparison of two assay methods for patterns of adherence to HEp-2 cells of Escherichia coli from patients with diarrhea. J Clin Microbiol. 1990;28:8825.PubMedGoogle Scholar
  12. Levine  MM, Nataro  JP, Karch  H, Baldini  MM, Kaper  JB, Black  RE, The diarrheal response of humans to some classic serotypes of enteropathogenic Escherichia coli is dependent on a plasmid encoding an enteroadhesiveness factor. J Infect Dis. 1985;152:5509. DOIPubMedGoogle Scholar
  13. Wood  PK, Morris  JG Jr, Small  PLC, Sethabutr  O, Toledo  MRF, Trabulsi  L, Comparison of DNA probes and the Sereny test for identification of invasive Shigella and Escherichia coli strains. J Clin Microbiol. 1986;24:498500.PubMedGoogle Scholar
  14. Satterwhite  TK, Evans  DG, DuPont  HL, Evans  DJ Jr. Role of Escherichia coli colonisation factor antigen in acute diarrhoea. Lancet. 1978;2:1814. DOIPubMedGoogle Scholar
  15. Perna  NT, Plunkett  G, Burland  V, Mau  B, Glasner  JD, Rose  DJ, Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature. 2001;409:52933. DOIPubMedGoogle Scholar
  16. Bettelheim  KA, Thompson  CJ. New method of serotyping Escherichia coli: implementation and verification. J Clin Microbiol. 1987;25:7816.PubMedGoogle Scholar
  17. Reid  SD, Betting  DJ, Whittam  TS. Molecular detection and identification of intimin alleles in pathogenic Escherichia coli by multiplex PCR. J Clin Microbiol. 1999;37:271922.PubMedGoogle Scholar
  18. Zhang  WL, Kohler  B, Oswald  E, Beutin  L, Karch  H, Morabito  S, Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. J Clin Microbiol. 2002;40:448692. DOIPubMedGoogle Scholar
  19. Newton  HJ, Sloan  J, Bennett-Wood  V, Adams  LM, Robins-Browne  RM, Hartland  EL. Contribution of long polar fimbriae to the virulence of rabbit-specific enteropathogenic Escherichia coli. Infect Immun. 2004;72:12307. DOIPubMedGoogle Scholar
  20. Klapproth  JM, Scaletsky  IC, McNamara  BP, Lai  LC, Malstrom  C, James  SP, A large toxin from pathogenic Escherichia coli strains that inhibits lymphocyte activation. Infect Immun. 2000;68:214855. DOIPubMedGoogle Scholar
  21. Yatsuyanagi  J, Saito  S, Sato  H, Miyajima  Y, Amano  K, Enomoto  K. Characterization of enteropathogenic and enteroaggregative Escherichia coli isolated from diarrheal outbreaks. J Clin Microbiol. 2002;40:2947. DOIPubMedGoogle Scholar
  22. Knutton  S, Phillips  AD, Smith  HR, Gross  RJ, Shaw  R, Watson  P, Screening for enteropathogenic Escherichia coli in infants with diarrhea by the fluorescent-actin staining test. Infect Immun. 1991;59:36571.PubMedGoogle Scholar
  23. McDaniel  TK, Jarvis  KG, Donnenberg  MS, Kaper  JB. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci U S A. 1995;92:16648. DOIPubMedGoogle Scholar
  24. Robins-Browne  RM, Bennett-Wood  V. Quantitative assessment of the ability of Escherichia coli to invade cultured animal cells. Microb Pathog. 1992;12:15964. DOIPubMedGoogle Scholar
  25. Nicholls  L, Grant  TH, Robins-Browne  RM. Identification of a novel locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol Microbiol. 2000;35:27588. DOIPubMedGoogle Scholar
  26. Yatsuyanagi  J, Saito  S, Miyajima  Y, Amano  K, Enomoto  K. Characterization of atypical enteropathogenic Escherichia coli strains harboring the astA gene that were associated with a waterborne outbreak of diarrhea in Japan. J Clin Microbiol. 2003;41:20339. DOIPubMedGoogle Scholar
  27. Scaletsky  IC, Pedroso  MZ, Oliva  CA, Carvalho  RL, Morais  MB, Fagundes-Neto  U. A localized adherence-like pattern as a second pattern of adherence of classic enteropathogenic Escherichia coli to HEp-2 cells that is associated with infantile diarrhea. Infect Immun. 1999;67:34105.PubMedGoogle Scholar
  28. Pelayo  JS, Scaletsky  IC, Pedroso  MZ, Sperandio  V, Girón  JA, Frankel  G, Virulence properties of atypical EPEC strains. J Med Microbiol. 1999;48:419. DOIPubMedGoogle Scholar
  29. Feng  P, Lampel  KA, Karch  H, Whittam  TS. Genotypic and phenotypic changes in the emergence of Escherichia coli O157:H7. J Infect Dis. 1998;177:17503. DOIPubMedGoogle Scholar
  30. Marshall  JA, Hellard  ME, Sinclair  MI, Fairley  CK, Cox  BJ, Catton  MG, Incidence and characteristics of endemic Norwalk-like virus-associated gastroenteritis. J Med Virol. 2003;69:56878. DOIPubMedGoogle Scholar
  31. Viljanen  MK, Peltola  T, Junnila  SY, Olkkonen  L, Jarvinen  H, Kuistila  M, Outbreak of diarrhoea due to Escherichia coli O111:B4 in schoolchildren and adults: association of Vi antigen-like reactivity. Lancet. 1990;336:8314. DOIPubMedGoogle Scholar
  32. Bouzari  S, Jafari  MN, Shokouhi  F, Parsi  M, Jafari  A. Virulence-related DNA sequences and adherence patterns in strains of enteropathogenic Escherichia coli. FEMS Microbiol Lett. 2000;185:8993. DOIPubMedGoogle Scholar
  33. Galane  PM, Le Roux  M. Molecular epidemiology of Escherichia coli isolated from young South African children with diarrhoeal diseases. J Health Popul Nutr. 2001;19:318.PubMedGoogle Scholar
  34. Knutton  S, Shaw  R, Phillips  AD, Smith  HR, Willshaw  GA, Watson  P, Phenotypic and genetic analysis of diarrhea-associated Escherichia coli isolated from children in the United Kingdom. J Pediatr Gastroenterol Nutr. 2001;33:3240. DOIPubMedGoogle Scholar
  35. Paciorek  J. Virulence properties of Escherichia coli faecal strains isolated in Poland from healthy children and strains belonging to serogroups O18, O26, O44, O86, O126 and O127 isolated from children with diarrhoea. J Med Microbiol. 2002;51:54856.PubMedGoogle Scholar
  36. Kukuruzovic  R, Robins-Browne  RM, Anstey  NM, Brewster  DR. Enteric pathogens, intestinal permeability and nitric oxide production in acute gastroenteritis. Pediatr Infect Dis J. 2002;21:7309. DOIPubMedGoogle Scholar
  37. Robins-Browne  RM, Yam  WC, O’Gorman  LE, Bettelheim  KA. Examination of archetypal strains of enteropathogenic Escherichia coli for properties associated with bacterial virulence. J Med Microbiol. 1993;38:2226. DOIPubMedGoogle Scholar
  38. Yamamoto  T, Taneike  I. The sequences of enterohemorrhagic Escherichia coli and Yersinia pestis that are homologous to the enteroaggregative E. coli heat-stable enterotoxin gene: cross-species transfer in evolution. FEBS Lett. 2000;472:226. DOIPubMedGoogle Scholar
  39. Beutin  L, Marches  O, Bettelheim  KA, Gleier  K, Zimmermann  S, Schmidt  H, HEp-2 cell adherence, actin aggregation, and intimin types of attaching and effacing Escherichia coli strains isolated from healthy infants in Germany and Australia. Infect Immun. 2003;71:39954002. DOIPubMedGoogle Scholar
  40. Vieira  MA, Andrade  JR, Trabulsi  LR, Rosa  AC, Dias  AM, Ramos  SR, Phenotypic and genotypic characteristics of Escherichia coli strains of non-enteropathogenic E. coli (EPEC) serogroups that carry EAE and lack the EPEC adherence factor and Shiga toxin DNA probe sequences. J Infect Dis. 2001;183:76272. DOIPubMedGoogle Scholar
  41. Francis  CL, Jerse  AE, Kaper  JB, Falkow  S. Characterization on interactions of enteropathogenic Escherichia coli O127:H6 with mammalian cells in vitro. J Infect Dis. 1991;164:693703. DOIPubMedGoogle Scholar

Main Article

1Current affiliation: Burnet Institute, Melbourne, Victoria, Australia.

Page created: April 11, 2011
Page updated: April 11, 2011
Page reviewed: April 11, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external