Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 11, Number 9—September 2005
Dispatch

Human Infection with Rickettsia honei, Thailand

Ju Jiang*, Vichai Sangkasuwan†, Kriangkrai Lerdthusnee‡, Suchitra Sukwit†, Thippawan Chuenchitra†, Patrick J. Rozmajzl*, Chirapa Eamsila†, James W. Jones‡, and Allen L. Richards*Comments to Author 
Author affiliations: *Naval Medical Research Center, Silver Spring, Maryland, USA; †Armed Forces Research Institute of Medical Sciences, Royal Thai Army, Bangkok, Thailand; ‡US Army Component, Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand

Cite This Article

Abstract

Human spotted fever rickettsiosis was detected molecularly by 2 real-time polymerase chain reaction (PCR) assays performed on DNA extracted from a Thai patient's serum sample. Sequences of PCR amplicons from 5 rickettsial genes used for multilocus sequence typing were 100% identical with those deposited with GenBank for Rickettsia honei TT-118.

The original Thai tick typhus isolate, TT-118, was obtained from a mixed pool of Ixodes sp. and Rhipicephalus sp. larval ticks from Rattus rattus trapped in Chiangmai Province, Thailand, in 1962 (1) and has recently been determined to be a strain of Rickettsia honei, the etiologic agent of Flinders Island spotted fever (2). No isolate has been associated with Thai tick typhus in humans, and TT-118 was found only to be moderately pathogenic for guinea pigs and gerbils (1). However, evidence of spotted fever rickettsiosis has been seen in Thailand; this evidence comes from 2 reports of a total of 11 cases, 3 cases from Chiangmai and 8 cases from the Thailand-Burma border. All 11 patients had signs and symptoms characteristic of spotted fever rickettsiosis, and their sera were reactive to spotted fever group (SFG) rickettsial antigens, including those derived from TT-118 (3,4). Additional proof of the presence of spotted fever rickettsiae in Thailand derives from rodent (5) and human (6,7) serosurveys. In addition, spotted fever agents have been demonstrated in Thai ticks by using molecular biology techniques to detect rickettsiae (810). Collectively, these reports indicate that SFG rickettsiae and rickettsioses exist within Thailand. However, at the time of this writing, detection of an SFG rickettsia from a human source had not been reported in Thailand.

The Study

We describe the first detection of R. honei TT-118 or a very similar strain from a 36-year-old male freelance photographer living in Bangkok, Thailand, who complained of a febrile illness and was admitted to a nearby hospital on December 21, 2002 (V. Sangkasuwan et al., unpub. data). Blood was collected and submitted to the Armed Forces Research Institute of Medical Sciences, Thailand, where the serum was determined to be positive for antibodies to spotted fever rickettsiae. A portion of this serum sample, without identifiers, was subsequently sent to the Naval Medical Research Center for confirmatory serologic and molecular diagnosis. To confirm the original serologic report, the patient's serum was tested for spotted fever, typhus, and scrub typhus group-specific immunoglobulin (Ig) G by enzyme-linked immunosorbent assay using R. rickettsii R (ATCC VR891), R. typhi Wilmington whole cell antigen, and KpKtGm r56 recombinant antigen, as previously described (11,12). The patient's serum was confirmed to have IgG to SFG rickettsiae (titer >1:6,400) but not to have antibodies to Orientia tsutsugamushi or R. typhi.

To ascertain whether the patient's serum contained molecular evidence of SFG rickettsia, DNA was extracted from 150 μL of the patient's serum (DNeasy Tissue Kit, Qiagen, Valencia, CA, USA). Three micrograms Poly(dA) (Sigma Chemical Co., St. Louis, MO, USA) was added as a DNA carrier. Two real-time polymerase chain reaction (PCR) assays were performed to determine if rickettsial nucleic acid was detectable in the patient's serum sample: 1) the Rickettsia genus–specific real-time PCR assay amplified and detected a 115-bp segment of the 17-kDa antigen gene and 2) the rickettsial SFG-specific real-time PCR amplified and detected a 128-bp segment of the ompB with a SmartCycler (Cepheid, Sunnyvale, CA, USA), as previously described (13). Both assays demonstrated the presence of the target sequences in the serum sample with Ct values of 36.22 and 36.87, respectively.

To identify which SFG rickettsia was responsible for the patient's febrile illness, segments of 5 rickettsial genes were amplified by PCR, and the amplicons produced were sequenced and compared to reported sequences of other SFG rickettsiae. New oligonucleotide primers were selected from the conserved regions of ompB, ompA, and sca4 after alignment of at least 19 rickettsial sequences: RompB11F (ACCATAGTAGCMAGTTTTGCAG), Rak1452R (SGTTAACTTKACCGYTTATAACTGT), RhoA1F (GAATAACATTACAAGCTGGAGGAA), RR657R (TATTTGCATCAATCSYATAAGWA), RhoA4336F (AGTTCAGGAAACGACCGTA), RrD749F (TGGTAGCATTAAAAGCTGATGG), RrD2685R (TTCAGTAGAAGATTTAGTACCAAAT), RrD1826R (TCTAAATKCTGCTGMATCAAT), and RrD1275R (TGTTAAACCTGYATTTACATAAT). All other primers used have been previously described (2,14,15).

To produce the amplicons used for sequencing, 2 μL or 4 μL of the sample DNA preparation was added to either a 25- or 50-μL reaction mixture, respectively, containing 0.5 μmol/L (for ompA and ompB), or 0.3 μmol/L (for 17-kDa gene, gltA and sca4) of forward and reverse primers, and PCR SuperMix High Fidelity (Invitrogen, Carlsbad, CA, USA). Two microliters of PCR products was used as template in the nested PCRs. Each PCR was performed on a TGradient Thermocycler (Whatman Biometra, Göttingen, Germany) and incubated at 94°C for 1 min followed by 40 cycles of denaturation at 94°C for 30 s; annealing at 48°C (gltA), 50°C (ompA and ompB), 52°C (sca4), or 58°C (17-kDa gene) for 1 min; and elongation at 70°C for 1–2 min. After the amplification steps were completed, the reaction mixtures were exposed to a final elongation step at 72°C for 7 min, and PCR products were visualized with ethidium bromide (GIBCO BRL Life Technologies, Inc., Gaithersburg, MD, USA) on 1.5% agarose gels after electrophoresis. Each mastermix for PCR was prepared in a clean room separated from where the DNA templates were added; no research with R. honei TT-118 had been conducted in our laboratory. A positive control DNA (R. parkeri genomic DNA) and a negative control (molecular biology grade water, GIBCO) were run at the same time under the same condition as the sample. The negative control consistently produced no detectable product. A 1,328-bp PCR product of ompB from the positive control DNA was sequenced and showed 100% identity with the published R. parkeri ompB sequence. The sample PCR products from the 17-kDa gene and the nested PCR products of gltA, ompA, ompB, and sca4 were purified by using a QIAquick PCR purification kit (Qiagen). The BigDye Terminator v 3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) was used in subsequent sequencing reactions, according to manufacturer's instructions. Sequencing products were purified by using Performa Gel Filtration Cartridges (EdgeBioSystems, Gaithersburg, MD, USA), and sequencing was performed on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems). The primers used for PCR amplification were the same as those used for the sequencing reactions. At least 2 sequencing reactions were performed for each strand of DNA. Sequences were assembled with Sequencher 4.0 (Gene Codes Corporation Inc., Ann Arbor MI, USA), and basic local alignment search tool (BLAST) searches were managed on the NCBI Web site (http://www.ncbi.nlm.nih.gov/blast/).

A 434-bp fragment from the 17-kD antigen gene was amplified by standard PCR, and the sequence between bases 67 and 458 of the open reading frame (ORF) was determined to be 100% identical with the published sequences of R. honei strain TT-118 and R. honei strain RB, and 99.7% identical with R. honei strain "south Texas A. [Amblyomma] cajennense SFG rickettsia." Two PCR fragments were produced for gltA by nested PCR that included bp 82 to 1178 of the ORF. A 1069-bp sequence was obtained after assembling the sequences of the 2 fragments. BLAST search showed this sequence to be 100% identical with that of R. honei TT-118 and 99.9% with R. honei strain RB. A 741-bp ompB fragment was amplified by nested PCR. Sequence of this fragment was found to have 100% identity with R. honei TT-118 and 99.8% with R. honei RB. The 1,403-bp ompA amplicon sequence had 100% identity with R. honei TT-118 and R. honei RB ompA published sequences. The 1,090-bp sequence determined for sca4 was 100% identical with that published for R. honei TT-118.

Conclusions

Molecular detection of R. honei TT-118 in a clinical specimen from a patient suspected of having spotted fever rickettsiosis was achieved after clinical diagnosis and serologic analysis. To determine the identity of SFG agent, standard PCR and nested PCR procedures were conducted to produce amplicons from 5 rickettsial genes for multilocus sequence typing (MLST) (10,15). The 17-kDa antigen gene, a highly conserved gene among members of the genus Rickettsia, was used to confirm the relationship of the unknown agent to known rickettsiae. Similarly, DNA encoding gltA was used to ascertain the relationship of the unknown agent to other agents within the genus Rickettsia. The sequences of the other 3 gene segments (ompB, ompA, and sca4) used in the MLST scheme are much more variable among the rickettsiae and, therefore, they provided more information regarding the identity of the unknown agent.

BLAST searches against the determined sequences of segments amplified from the 17-kDa antigen, citrate synthase, OmpB, OmpA, and Sca4 genes of the unknown agent showed 100% identity with those sequences deposited within GenBank for R. honei TT-118. The closest other neighbors to the unknown agent included R. honei RB (the type strain of R. honei) and R. honei "south Texas A. cajennense SFG rickettsia." Thus, the patient at the time of his illness was infected with R. honei TT-118 or a very similar strain of SFG rickettsiae.

Dr. Jiang has been developing and performing immunologic and molecular biologic assays in the Rickettsial Diseases Department of the Naval Medical Research Center, Silver Spring, Maryland, for >5 years. Her research interests include rickettsial epidemiology, study of the host immune response to rickettsial infection, and rapid diagnostic assay and vaccine development.

Top

Acknowledgment

The work reported herein was supported by the Department of Defense Global Emerging Infections System program (work unit number 0000188M.0931.001.A0074).

Top

References

  1. Robertson  RG, Wisseman  CL Jr. Tick-borne rickettsiae of the spotted fever group in West Pakistan. II. Serological classification of isolates from West Pakistan and Thailand: evidence for two new species. Am J Epidemiol. 1973;97:5564.PubMedGoogle Scholar
  2. Stenos  J, Roux  V, Walker  D, Raoult  D. Rickettsia honei sp. nov., the etiological agent of Flinders Island spotted fever in Australia. Int J Syst Bacteriol. 1998;48:1399404. DOIPubMedGoogle Scholar
  3. Sirisanthana  T, Pinyopornpanit  V, Sirisanthana  V, Strickman  D, Kelly  DJ, Dasch  GA. First cases of spotted fever group rickettsiosis in Thailand. Am J Trop Med Hyg. 1994;50:6826.PubMedGoogle Scholar
  4. Parola  P, Miller  RS, McDaniel  P, Telford  SR, Rolain  J-M, Wongsrichanalai  C, Emerging rickettsioses of the Thai-Myanmar border. Emerg Infect Dis. 2003;9:5925.PubMedGoogle Scholar
  5. Okabayashi  T, Tsutiya  K, Muramatsu  Y, Ueno  H, Morita  C. Serological survey of spotted fever group rickettsia in wild rats in Thailand in the 1970s. Microbiol Immunol. 1996;40:8958.PubMedGoogle Scholar
  6. Takada  N, Fujita  H, Yano  Y, Huang  W-H, Khamboonruang  C. Serosurveys of spotted fever and murine typhus in local residents of Taiwan and Thailand compared with Japan. Southeast Asian J Trop Med Public Health. 1993;24:3546.PubMedGoogle Scholar
  7. Strickman  D, Tanskul  P, Eamsila  C, Kelly  DJ. Prevalence of antibodies to rickettsiae in the human population of suburban Bangkok. Am J Trop Med Hyg. 1994;51:14953.PubMedGoogle Scholar
  8. Kollars  TM Jr, Tippayachai  B, Bodhidatta  D. Short report: Thai tick typhus, Rickettsia honei, and a unique rickettsia detected in Ixodes granulatus (Ixodidae: Acari) from Thailand. Am J Trop Med Hyg. 2001;65:5357.PubMedGoogle Scholar
  9. Hirunkanokpun  S, Kittayapong  P, Cornet  J-P, Gonzalez  J-P. Molecular evidence for novel tick-associated spotted fever group rickettsiae from Thailand. J Med Entomol. 2003;40:2307. DOIPubMedGoogle Scholar
  10. Parola  P, Cornet  J-P, Sanogo  YO, Miller  RS, Thien  HV, Gonzalez  J-P, Detection of Ehrlichia spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam. J Clin Microbiol. 2003;41:16008. DOIPubMedGoogle Scholar
  11. Jiang  J, Marienau  KJ, May  LA, Beecham  HJ, Wilkinson  R, Ching  W-M, Laboratory diagnosis of two scrub typhus outbreaks at Camp Fuji, Japan in 2000 and 2001 by enzyme-linked immunosorbent assay, rapid flow assay, and Western blot assay using outer membrane 56 kDa recombinant proteins. Am J Trop Med Hyg. 2003;69:606.PubMedGoogle Scholar
  12. Richards  AL, Soeatmandji  DW, Widodo  MA, Sardjono  TW, Yanuwiadi  B, Hernowati  TE, Seroepidemiological evidence for murine and scrub typhus in Malang, Indonesia. Am J Trop Med Hyg. 1997;57:915.PubMedGoogle Scholar
  13. Blair  PJ, Jiang  J, Schoeler  GB, Moron  C, Anaya  E, Cespedes  M, Characterization of spotted fever group rickettsiae in flea and tick specimens from northern Peru. J Clin Microbiol. 2004;42:49617. DOIPubMedGoogle Scholar
  14. Webb  L, Carl  M, Malloy  DC, Dasch  GA, Azad  AF. Detection of murine typhus infection in fleas by using the polymerase chain reaction. J Clin Microbiol. 1990;28:5304.PubMedGoogle Scholar
  15. Fournier  P-E, Dumler  JS, Greub  G, Zhang  J, Wu  Y, Raoult  D. Gene sequence-based criteria for identification of new Rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J Clin Microbiol. 2003;41:545665. DOIPubMedGoogle Scholar

Top

Cite This Article

DOI: 10.3201/eid1109.050011

Table of Contents – Volume 11, Number 9—September 2005

EID Search Options
presentation_01 Advanced Article Search – Search articles by author and/or keyword.
presentation_01 Articles by Country Search – Search articles by the topic country.
presentation_01 Article Type Search – Search articles by article type and issue.

Top

Comments

Please use the form below to submit correspondence to the authors or contact them at the following address:

Allen L. Richards, Rickettsial Diseases Department, Naval Medical Research Center, 503 Robert Grant Ave, Silver Spring, MD 20910-7500 USA; fax: 301-319-7460

Send To

10000 character(s) remaining.

Top

Page created: April 23, 2012
Page updated: April 23, 2012
Page reviewed: April 23, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external