Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 8, Number 7—July 2002

Mycobacterium avium subsp. paratuberculosis Infection in a Patient with HIV, Germany

Elvira Richter*Comments to Author , Johannes Wessling†, Norbert Lügering†, Wolfram Domschke†, and Sabine Rüsch-Gerdes*
Author affiliations: *National Reference Center for Mycobacteria, Borstel, Germany; †University of Münster, Münster, Germany;

Cite This Article


Mycobacterium avium subsp. paratuberculosis (MAP), the causative agent of Johne disease in ruminants, has been incriminated as the cause of Crohn disease in humans. We report the first case of human infection with MAP in a patient with HIV; infection was confirmed by obtaining isolates from several different specimen types.

Opportunistic infections caused by various Mycobacterium species are among the leading AIDS indicator diseases in HIV-positive patients (1). Infections with nontuberculous mycobacteria occur mainly in patients who have low CD4+ counts (<50 cells) or high virus counts (2); Mycobacterium avium complex is the most important mycobacterial species. M. avium complex includes the species M. avium and M. intracellulare, with M. avium consisting of M. avium subsp. avium, M. avium subsp. sylvaticum, and M. avium subsp. paratuberculosis (MAP). All these subspecies have identical 16S rRNA gene and 16S to 23S transcribed spacer sequences, as well as shared biochemical characteristics (3). However, MAP is dependent on mycobactin for its growth, whereas M. avium grows well on different solid media.

MAP is the causative agent of Johne disease, a chronic granulomatous ileitis occurring mainly in ruminants (4). MAP has been incriminated as the cause of Crohn disease in humans (5,6), although conflicting findings have been reported. However, culture-confirmed cases of MAP in human specimens remain rare (5,6).

Case Report

A 36-year-old HIV-positive man, who had been treated at our hospital since 1995 for HIV, hepatitis C, and hemophilia, had profuse diarrhea (6–8 episodes/day), fever as high as 39.9°C, and 10 kg of body weight loss in 5 weeks. Laboratory findings included hemoglobin 9.6 g/dL, pseudocholinesterase 2,099 U/L, HIV-DNA virus count 500 copies/mL, CD4+ lymphocyte count 29 x 106/mL, and C-reactive protein 76 mg/L. Stained colon tissue samples, bone marrow punch, and liver biopsy showed abundant acid-fast bacilli. Endoscopic findings on colonoscopy were multiple polypoid lesions approximately 5 mm in size in the transverse and sigmoid colon.

Figure 1

Thumbnail of Ziehl-Neelsen–stained micrograph of Mycobacterium avium subsp. paratuberculosis colonies growing on mycobactin-supplemented Middlebrook agar.

Figure 1. Ziehl-Neelsen–stained micrograph of Mycobacterium avium subsp. paratuberculosis colonies growing on mycobactin-supplemented Middlebrook agar.

Microbiologic analyses included culture for mycobacteria (liquid media: BACTEC 460TB or MGIT [Becton, Dickinson and Company, Cockeysville, MD] and solid media produced in-house, all media without supplementation of mycobactin) from at least 21 specimens (blood, urine, sputum, biopsy, feces) over a 3-year period. Of these, eight specimens (blood, feces, and biopsy) were positive for mycobacteria in liquid media after 6 to 16 weeks of incubation. Subcultures remained negative on Löwenstein-Jensen slants but after approximately 4 weeks became positive on mycobactin-supplemented Middlebrook slants with colorless dysgonic colonies. Microscopic examination of these colonies showed acid-fast bacilli (Figure 1).

Figure 2

Thumbnail of Agarose gel electrophoresis of amplified IS900 fragments. Lanes 1 and 6: molecular weight marker (2176, 1766, 1230, 1033, 653, 517, 453, 394, 298, 234–220, 154 bp); lanes 2 and 3: two patient samples; lane 4: positive control (Mycobacterium avium subsp. paratuberculosis type strain); and lane 5: negative control (Mycobacterium avium strain).

Figure 2. Agarose gel electrophoresis of amplified IS900 fragments. Lanes 1 and 6: molecular weight marker (2176, 1766, 1230, 1033, 653, 517, 453, 394, 298, 234–220, 154 bp); lanes 2 and 3: two...

For species identification, AccuProbe assays (Gen-Probe, San Diego, CA) for M. avium complex were performed on liquid media, all yielding strong positive results. However, repeated attempts to perform drug-susceptibility testing in the liquid BACTEC 460TB system were unsuccessful because of insufficient growth of the control. Since M. avium complex usually grows very well, the primary identification was questionable. Thus, polymerase chain reaction (PCR) for the amplification of a part of the mycobacterial gene coding for the ribosomal 16S RNA and additional sequencing was performed from two positive cultures (7). The resulting sequence was compared with those stored in the International Nucleotide Sequence Database (8), showing the signature sequence of M. avium/M. paratuberculosis, which is identical for both species and confirmed the AccuProbe results. For further differentiation between M. avium and MAP, PCR targeting the insertion sequence IS900 (primer: IS900-1: 5´ TGTTCGGGGCCGTCGCTTAG; IS900-2: 5´-CGTTCCAGCGCCGAAAGTAT), which is present only in MAP strains (9), was done with the two most recent positive cultures. This assay showed clearly positive results from the two cultures tested and the MAP type strain, while the M. avium strains remained negative (Figure 2).

Because acid-fast bacilli were identified in biopsy specimens, treatment was started with ethambutol, ciprofloxacin, clarithromycin, and rifabutin. Initially, no clinical improvement was observed, and the patient’s weight loss and daily fever of 39C°–40°C continued. When ciprofloxacin was replaced with levofloxacin, progression of the infection appeared to stop. However, the patient died from cardiorespiratory failure.


We describe the case of an HIV-infected patient who had a severe mycobacterial disorder thought to be caused by M. avium complex. Because growth was insufficient for susceptibility testing, the presence of MAP was assumed; however, the assumption was made after 2 years, because of difficulties in isolating MAP from human specimens (e.g., blood) in media not thought to enable its growth. Finally, the demonstration of the insertion sequence IS900, an assay not routinely performed in human diagnostic laboratories like ours, confirmed this hypothesis.

MAP isolated from human specimens has not yet been demonstrated by routine techniques. Several studies have reported the presence of MAP DNA in association with Crohn disease, although culture confirmation remains rare in these patients (5,6).

In the case we describe, mycobacterial growth could be detected in liquid media in 8 of 21 specimens, all confirmed as M. avium complex/M. paratuberculosis. However, because of the limited growth, we assume the presence of MAP even in those specimens not tested by IS900 PCR. These results indicate that MAP can grow to a limited extent in routine liquid media without mycobactin supplementation, at least if present in high amounts in the specimen.

Susceptibility testing of the isolated strains could not be performed because of insufficient growth. Reports on susceptibility testing of MAP are rare, yet data obtained by a luciferase-based susceptibility assay (10) indicate susceptibility at least to clarithromycin and rifabutin, which were included in therapy. However, the patient’s response to treatment was not clearly positive and may have been hampered by his general poor health. This report suggests a pathogenic role of MAP for immunocompromised patients, raising the question of whether this strain so far has not been detected because of its limited growth, whether it has been misidentified as M. avium, or whether its occurrence in infections is low. However, herd prevalence of bovine paratuberculosis has been reported to range from 7% to 55% in Europe and to reach approximately 40% in stocks of >300 animals in the United States (4). Thus, consumption of inadequately pasteurized dairy products may be a possible risk for infection, especially for immunocompromised patients.

Dr. Richter is deputy of the German National Reference Center for Mycobacteria, Borstel. She is a specialist in molecular microbiology.



We thank Marie Thorel for providing the MAP type strain used as positive control for IS900 PCR and Frauke Schaefer for excellent technical assistance.



  1. European Centre for the Epidemiological Monitoring of AIDS. HIV/AIDS surveillance in Europe. Updated June 30, 2001. Available from URL:
  2. Brambilla  AM, Castagna  A, Nocita  B, Hasson  H, Boeri  E, Veglia  F, Relation between CD4 cell counts and HIV RNA levels at onset of opportunistic infections. J Acquir Immune Defic Syndr. 2001;27:448.PubMed
  3. Thorel  MF, Krichevsky  M, Levy-Frebault  VV. Numerical taxonomy of mycobactin-dependent mycobacteria, emended description of Mycobacterium avium, and description of Mycobacterium avium subsp. avium subsp. nov., Mycobacterium avium subsp. paratuberculosis subsp. nov., and Mycobacterium avium subsp. silvaticum subsp. nov. Int J Syst Bacteriol. 1990;40:25460.PubMed
  4. Manning  EJ, Collins  MT. Mycobacterium avium subsp. paratuberculosis: pathogen, pathogenesis and diagnosis. Rev Sci Tech. 2001;20:13350.PubMed
  5. Collins  MT, Lisby  G, Moser  C, Chicks  D, Christensen  S, Reichelderfer  M, Results of multiple diagnostic tests for Mycobacterium avium subsp. paratuberculosis in patients with inflammatory bowel disease and in controls. J Clin Microbiol. 2000;38:437381.PubMed
  6. Schwartz  D, Shafran  I, Romero  C, Piromalli  C, Biggerstaff  J, Naser  N, Use of short-term culture for identification of Mycobacterium avium subsp. paratuberculosis in tissue from Crohn's disease patients. Clin Microbiol Infect. 2000;6:3037. DOIPubMed
  7. Richter  E, Greinert  U, Kirsten  D, Rüsch-Gerdes  S, Schlüter  C, Duchrow  M, Assessment of mycobacterial DNA in cells and tissues of mycobacterial and sarcoid lesions. Am J Respir Crit Care Med. 1996;153:37580.PubMed
  8. National Institutes of Health. International nucleotide sequence database collaboration. Available from URL:
  9. Bauernfeind  R, Benazzi  S, Weiss  R, Schliesser  T, Willems  H, Baljer  G. Molecular characterization of Mycobacterium paratuberculosis isolates from sheep, goats, and cattle by hybridization with a DNA probe to insertion element IS900. J Clin Microbiol. 1996;34:161721.PubMed
  10. Williams  SL, Harris  NB, Barletta  RG. Development of a firefly luciferase-based assay for determining antimicrobial susceptibility of Mycobacterium avium subsp. paratuberculosis. J Clin Microbiol. 1999;37:3049.PubMed




Cite This Article

DOI: 10.3201/eid0807.010388

Table of Contents – Volume 8, Number 7—July 2002


Please use the form below to submit correspondence to the authors or contact them at the following address:

Elvira Richter, Forschungszentrum Borstel, National Reference Center for Mycobacteria, Parkallee 18, 23845 Borstel, Germany; fax: 49-4537-188311;

Send To

10000 character(s) remaining.


Page created: July 16, 2010
Page updated: July 16, 2010
Page reviewed: July 16, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.