Table 1

Candidatus Neoehrlichia mikurensis Infection in Patient with Antecedent Hematologic Neoplasm, Spain¹

Paola González-Carmona²³, Aránzazu Portillo², Cristina Cervera-Acedo, Daniel González-Fernández, and José A. Oteo

Author affiliations: Hospital de Jarrio, Asturias, Spain (P. González-Carmona, D. González-Fernández); Hospital Universitario San Pedro-CIBIR, La Rioja, Spain (A. Portillo, C. Cervera-Acedo, J.A. Oteo)

Main Article

PCR primer pairs and conditions used in study of Candidatus Neoehrlichia mikurensis infection in patient with antecedent hematologic neoplasm, Spain*

Organisms	Target gene	Primer name	Primer sequence, 5′ → 3′	Amplicon size	Tm, °C
Bacteria	16S rRNA	fD1	AGAGTTTGATCCTGGCTCAG	1,500 bp	60
Bacteria	16S rRNA	rP2	ACGGCTACCTTGTTACGACTT	1,500 bp	60
Anaplasmataceae†	16S rRNA-EHR	EHR16SD	GGTACCYACAGAAGAAGTCC	345 bp	55
Anaplasmataceae†	16S rRNA-EHR	EHR16SR	TAGCACTCATCGTTTACAGC	345 bp	55
Anaplasma phagocytophilum	msp2	msp2–3F	CCAGCGTTTAGCAAGATAAGAG	334 bp	56
Anaplasma phagocytophilum	msp2	msp2–3R	GCCCAGTAACAACATCATAAGC	334 bp	56
Candidatus N. mikurensis	groEL, 1st run	Ne-groEL-F	GAAGTATAGTTTAGTATTTTTGTC	1,275 bp	49
	groEL, 1st run	Ne-groEL-R	TTAACTTCTACTTCGCTTG	1,275 bp	49
	groEL, 2nd run	Ne-groEL-F	GAAGTATAGTTTAGTATTTTTGTC	510 bp	49
	groEL, 2nd run	Ne-groEL_ne-1	ACATCACGTTTCATAGAA	510 bp	49
	groEL, 2nd run	Ne-groEL_ne-2	AAAGGAATTAGTATTAGAATCTTT	569 bp	49
	groEL, 2nd run	Ne-groEL_ne-4	CTTCCATTTTAACTGCTAA	569 bp	49
	groEL, 2nd run	Ne-groEL_ne-3	AATATAGCAAGATCAGGTAGAC	461 bp	49
	groEL, 2nd run	Ne-groEL-R	TTAACTTCTACTTCGCTTG	461 bp	49

*Tm, melting temperature. †Includes Anaplasma, Ehrlichia, and Candidatus Neoehrlichia spp. 16S rRNA-EHR refers to the 16S rRNA sequence from the Anaplasmataceae family members, whereas 16S rRNA refers to the panbacterial 16S rRNA sequence.

Main Article

¹Data from this study were presented at the joint LXIV National Conference of the Spanish Society of Hematology and Hemotherapy, XXXVIII National Conference of the Spanish Society of Thrombosis and Hemostasis, and 38th World Congress of the International Society of Hematology; October 6–8, 2022; Barcelona, Spain; and International Intracellular Bacteria Meeting; August 23–26, 2022; Lausanne, Switzerland.

²These first authors contributed equally to this article.

³Current affiliation: Hospital Universitario San Agustín, Asturias, Spain.

Page created: June 13, 2023

Page updated: July 20, 2023

Page reviewed: July 20, 2023

The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.

Volume 29, Number 8—August 2023

Dispatch

Candidatus Neoehrlichia mikurensis Infection in Patient with Antecedent Hematologic Neoplasm, Spain1

Table 1

Candidatus Neoehrlichia mikurensis Infection in Patient with Antecedent Hematologic Neoplasm, Spain¹